ID: 1144132281

View in Genome Browser
Species Human (GRCh38)
Location 17:12258151-12258173
Sequence TCAAACTTTGGAGGACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132275_1144132281 -3 Left 1144132275 17:12258131-12258153 CCTTGGTTTTCCCAAGGTGATCA No data
Right 1144132281 17:12258151-12258173 TCAAACTTTGGAGGACAGATGGG No data
1144132274_1144132281 1 Left 1144132274 17:12258127-12258149 CCAGCCTTGGTTTTCCCAAGGTG No data
Right 1144132281 17:12258151-12258173 TCAAACTTTGGAGGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132281 Original CRISPR TCAAACTTTGGAGGACAGAT GGG Intergenic
No off target data available for this crispr