ID: 1144132283

View in Genome Browser
Species Human (GRCh38)
Location 17:12258158-12258180
Sequence TTGGAGGACAGATGGGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132278_1144132283 -7 Left 1144132278 17:12258142-12258164 CCAAGGTGATCAAACTTTGGAGG No data
Right 1144132283 17:12258158-12258180 TTGGAGGACAGATGGGCCACGGG No data
1144132274_1144132283 8 Left 1144132274 17:12258127-12258149 CCAGCCTTGGTTTTCCCAAGGTG No data
Right 1144132283 17:12258158-12258180 TTGGAGGACAGATGGGCCACGGG No data
1144132275_1144132283 4 Left 1144132275 17:12258131-12258153 CCTTGGTTTTCCCAAGGTGATCA No data
Right 1144132283 17:12258158-12258180 TTGGAGGACAGATGGGCCACGGG No data
1144132277_1144132283 -6 Left 1144132277 17:12258141-12258163 CCCAAGGTGATCAAACTTTGGAG No data
Right 1144132283 17:12258158-12258180 TTGGAGGACAGATGGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132283 Original CRISPR TTGGAGGACAGATGGGCCAC GGG Intergenic
No off target data available for this crispr