ID: 1144132456

View in Genome Browser
Species Human (GRCh38)
Location 17:12259966-12259988
Sequence GCCCCCCTTAGACCCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144132456_1144132470 26 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132470 17:12260015-12260037 TCTTGGGGTTCTTGGAAAGGGGG No data
1144132456_1144132463 11 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132463 17:12260000-12260022 ACAGCCTTTGCCAGATCTTGGGG No data
1144132456_1144132469 25 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132469 17:12260014-12260036 ATCTTGGGGTTCTTGGAAAGGGG No data
1144132456_1144132467 23 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132467 17:12260012-12260034 AGATCTTGGGGTTCTTGGAAAGG No data
1144132456_1144132465 18 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132465 17:12260007-12260029 TTGCCAGATCTTGGGGTTCTTGG No data
1144132456_1144132468 24 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132468 17:12260013-12260035 GATCTTGGGGTTCTTGGAAAGGG No data
1144132456_1144132461 9 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132461 17:12259998-12260020 CTACAGCCTTTGCCAGATCTTGG No data
1144132456_1144132462 10 Left 1144132456 17:12259966-12259988 CCCTTCAGGGGTCTAAGGGGGGC No data
Right 1144132462 17:12259999-12260021 TACAGCCTTTGCCAGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144132456 Original CRISPR GCCCCCCTTAGACCCCTGAA GGG (reversed) Intergenic
No off target data available for this crispr