ID: 1144136700

View in Genome Browser
Species Human (GRCh38)
Location 17:12302117-12302139
Sequence CTGGAGACCGAGAAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144136700_1144136706 14 Left 1144136700 17:12302117-12302139 CCATTCTCCTTCTCGGTCTCCAG No data
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136700_1144136704 -5 Left 1144136700 17:12302117-12302139 CCATTCTCCTTCTCGGTCTCCAG No data
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144136700 Original CRISPR CTGGAGACCGAGAAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr