ID: 1144136704

View in Genome Browser
Species Human (GRCh38)
Location 17:12302135-12302157
Sequence TCCAGAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 739937
Summary {0: 4092, 1: 106823, 2: 236369, 3: 242729, 4: 149924}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144136696_1144136704 9 Left 1144136696 17:12302103-12302125 CCTCCCGGGTCACGCCATTCTCC 0: 17
1: 120
2: 768
3: 2217
4: 5844
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924
1144136698_1144136704 5 Left 1144136698 17:12302107-12302129 CCGGGTCACGCCATTCTCCTTCT No data
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924
1144136697_1144136704 6 Left 1144136697 17:12302106-12302128 CCCGGGTCACGCCATTCTCCTTC No data
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924
1144136695_1144136704 12 Left 1144136695 17:12302100-12302122 CCGCCTCCCGGGTCACGCCATTC 0: 16
1: 86
2: 279
3: 879
4: 2389
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924
1144136700_1144136704 -5 Left 1144136700 17:12302117-12302139 CCATTCTCCTTCTCGGTCTCCAG No data
Right 1144136704 17:12302135-12302157 TCCAGAGTAGCTGGGACTACAGG 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144136704 Original CRISPR TCCAGAGTAGCTGGGACTAC AGG Intergenic
Too many off-targets to display for this crispr