ID: 1144136706

View in Genome Browser
Species Human (GRCh38)
Location 17:12302154-12302176
Sequence CAGGCGCCTGCCACTACGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206382
Summary {0: 216, 1: 8208, 2: 27873, 3: 61370, 4: 108715}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144136705_1144136706 -5 Left 1144136705 17:12302136-12302158 CCAGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136696_1144136706 28 Left 1144136696 17:12302103-12302125 CCTCCCGGGTCACGCCATTCTCC 0: 17
1: 120
2: 768
3: 2217
4: 5844
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136698_1144136706 24 Left 1144136698 17:12302107-12302129 CCGGGTCACGCCATTCTCCTTCT No data
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136700_1144136706 14 Left 1144136700 17:12302117-12302139 CCATTCTCCTTCTCGGTCTCCAG No data
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136697_1144136706 25 Left 1144136697 17:12302106-12302128 CCCGGGTCACGCCATTCTCCTTC No data
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715
1144136701_1144136706 7 Left 1144136701 17:12302124-12302146 CCTTCTCGGTCTCCAGAGTAGCT No data
Right 1144136706 17:12302154-12302176 CAGGCGCCTGCCACTACGCCCGG 0: 216
1: 8208
2: 27873
3: 61370
4: 108715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144136706 Original CRISPR CAGGCGCCTGCCACTACGCC CGG Intergenic
Too many off-targets to display for this crispr