ID: 1144137713

View in Genome Browser
Species Human (GRCh38)
Location 17:12314401-12314423
Sequence GTACCACCCAATAGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144137713_1144137716 -3 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137716 17:12314421-12314443 TACCAGCCAAAGCACTTTGTTGG No data
1144137713_1144137722 3 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137722 17:12314427-12314449 CCAAAGCACTTTGTTGGGGGTGG No data
1144137713_1144137717 -2 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137717 17:12314422-12314444 ACCAGCCAAAGCACTTTGTTGGG No data
1144137713_1144137720 0 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137720 17:12314424-12314446 CAGCCAAAGCACTTTGTTGGGGG No data
1144137713_1144137719 -1 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137719 17:12314423-12314445 CCAGCCAAAGCACTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144137713 Original CRISPR GTACCACCCAATAGAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr