ID: 1144137715

View in Genome Browser
Species Human (GRCh38)
Location 17:12314405-12314427
Sequence GCTGGTACCACCCAATAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144137715_1144137717 -6 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137717 17:12314422-12314444 ACCAGCCAAAGCACTTTGTTGGG No data
1144137715_1144137716 -7 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137716 17:12314421-12314443 TACCAGCCAAAGCACTTTGTTGG No data
1144137715_1144137720 -4 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137720 17:12314424-12314446 CAGCCAAAGCACTTTGTTGGGGG No data
1144137715_1144137719 -5 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137719 17:12314423-12314445 CCAGCCAAAGCACTTTGTTGGGG No data
1144137715_1144137722 -1 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137722 17:12314427-12314449 CCAAAGCACTTTGTTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144137715 Original CRISPR GCTGGTACCACCCAATAGAG TGG (reversed) Intergenic