ID: 1144137719

View in Genome Browser
Species Human (GRCh38)
Location 17:12314423-12314445
Sequence CCAGCCAAAGCACTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144137713_1144137719 -1 Left 1144137713 17:12314401-12314423 CCACCCACTCTATTGGGTGGTAC No data
Right 1144137719 17:12314423-12314445 CCAGCCAAAGCACTTTGTTGGGG No data
1144137715_1144137719 -5 Left 1144137715 17:12314405-12314427 CCACTCTATTGGGTGGTACCAGC No data
Right 1144137719 17:12314423-12314445 CCAGCCAAAGCACTTTGTTGGGG No data
1144137714_1144137719 -4 Left 1144137714 17:12314404-12314426 CCCACTCTATTGGGTGGTACCAG No data
Right 1144137719 17:12314423-12314445 CCAGCCAAAGCACTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144137719 Original CRISPR CCAGCCAAAGCACTTTGTTG GGG Intergenic
No off target data available for this crispr