ID: 1144140504

View in Genome Browser
Species Human (GRCh38)
Location 17:12342750-12342772
Sequence TTCACCCACAGGAGCCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140504_1144140512 24 Left 1144140504 17:12342750-12342772 CCAAACAGGCTCCTGTGGGTGAA No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140504_1144140516 27 Left 1144140504 17:12342750-12342772 CCAAACAGGCTCCTGTGGGTGAA No data
Right 1144140516 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
1144140504_1144140513 25 Left 1144140504 17:12342750-12342772 CCAAACAGGCTCCTGTGGGTGAA No data
Right 1144140513 17:12342798-12342820 CTCCCCCCATCCCTCCAGCAGGG No data
1144140504_1144140514 26 Left 1144140504 17:12342750-12342772 CCAAACAGGCTCCTGTGGGTGAA No data
Right 1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140504 Original CRISPR TTCACCCACAGGAGCCTGTT TGG (reversed) Intergenic
No off target data available for this crispr