ID: 1144140506

View in Genome Browser
Species Human (GRCh38)
Location 17:12342761-12342783
Sequence GGAGTCCTGGGTTCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140506_1144140514 15 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG No data
1144140506_1144140513 14 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140513 17:12342798-12342820 CTCCCCCCATCCCTCCAGCAGGG No data
1144140506_1144140521 23 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140521 17:12342807-12342829 TCCCTCCAGCAGGGGGCAGTAGG No data
1144140506_1144140516 16 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140516 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
1144140506_1144140512 13 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140506 Original CRISPR GGAGTCCTGGGTTCACCCAC AGG (reversed) Intergenic
No off target data available for this crispr