ID: 1144140509

View in Genome Browser
Species Human (GRCh38)
Location 17:12342782-12342804
Sequence GGGGGAGGAGGCAGAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140509_1144140512 -8 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140509_1144140527 28 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140527 17:12342833-12342855 CTCTAGCTTTTGCTAATCTTGGG No data
1144140509_1144140514 -6 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG No data
1144140509_1144140516 -5 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140516 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
1144140509_1144140521 2 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140521 17:12342807-12342829 TCCCTCCAGCAGGGGGCAGTAGG No data
1144140509_1144140513 -7 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140513 17:12342798-12342820 CTCCCCCCATCCCTCCAGCAGGG No data
1144140509_1144140526 27 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140509_1144140528 29 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140528 17:12342834-12342856 TCTAGCTTTTGCTAATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140509 Original CRISPR GGGGGAGGAGGCAGAGTCTC AGG (reversed) Intergenic