ID: 1144140510

View in Genome Browser
Species Human (GRCh38)
Location 17:12342794-12342816
Sequence GCTGGAGGGATGGGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140510_1144140528 17 Left 1144140510 17:12342794-12342816 CCTCCTCCCCCCATCCCTCCAGC No data
Right 1144140528 17:12342834-12342856 TCTAGCTTTTGCTAATCTTGGGG No data
1144140510_1144140521 -10 Left 1144140510 17:12342794-12342816 CCTCCTCCCCCCATCCCTCCAGC No data
Right 1144140521 17:12342807-12342829 TCCCTCCAGCAGGGGGCAGTAGG No data
1144140510_1144140526 15 Left 1144140510 17:12342794-12342816 CCTCCTCCCCCCATCCCTCCAGC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140510_1144140527 16 Left 1144140510 17:12342794-12342816 CCTCCTCCCCCCATCCCTCCAGC No data
Right 1144140527 17:12342833-12342855 CTCTAGCTTTTGCTAATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140510 Original CRISPR GCTGGAGGGATGGGGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr