ID: 1144140512

View in Genome Browser
Species Human (GRCh38)
Location 17:12342797-12342819
Sequence CCTCCCCCCATCCCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140508_1144140512 0 Left 1144140508 17:12342774-12342796 CCAGGACTCCTGAGACTCTGCCT No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140506_1144140512 13 Left 1144140506 17:12342761-12342783 CCTGTGGGTGAACCCAGGACTCC No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140504_1144140512 24 Left 1144140504 17:12342750-12342772 CCAAACAGGCTCCTGTGGGTGAA No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140503_1144140512 27 Left 1144140503 17:12342747-12342769 CCACCAAACAGGCTCCTGTGGGT No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140509_1144140512 -8 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
1144140507_1144140512 1 Left 1144140507 17:12342773-12342795 CCCAGGACTCCTGAGACTCTGCC No data
Right 1144140512 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140512 Original CRISPR CCTCCCCCCATCCCTCCAGC AGG Intergenic
No off target data available for this crispr