ID: 1144140515

View in Genome Browser
Species Human (GRCh38)
Location 17:12342800-12342822
Sequence CCCCCTGCTGGAGGGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140515_1144140528 11 Left 1144140515 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
Right 1144140528 17:12342834-12342856 TCTAGCTTTTGCTAATCTTGGGG No data
1144140515_1144140527 10 Left 1144140515 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
Right 1144140527 17:12342833-12342855 CTCTAGCTTTTGCTAATCTTGGG No data
1144140515_1144140526 9 Left 1144140515 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140515 Original CRISPR CCCCCTGCTGGAGGGATGGG GGG (reversed) Intergenic