ID: 1144140517

View in Genome Browser
Species Human (GRCh38)
Location 17:12342801-12342823
Sequence GCCCCCTGCTGGAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140517_1144140527 9 Left 1144140517 17:12342801-12342823 CCCCCATCCCTCCAGCAGGGGGC No data
Right 1144140527 17:12342833-12342855 CTCTAGCTTTTGCTAATCTTGGG No data
1144140517_1144140528 10 Left 1144140517 17:12342801-12342823 CCCCCATCCCTCCAGCAGGGGGC No data
Right 1144140528 17:12342834-12342856 TCTAGCTTTTGCTAATCTTGGGG No data
1144140517_1144140526 8 Left 1144140517 17:12342801-12342823 CCCCCATCCCTCCAGCAGGGGGC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140517 Original CRISPR GCCCCCTGCTGGAGGGATGG GGG (reversed) Intergenic
No off target data available for this crispr