ID: 1144140520

View in Genome Browser
Species Human (GRCh38)
Location 17:12342804-12342826
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140520_1144140529 30 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data
1144140520_1144140527 6 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140527 17:12342833-12342855 CTCTAGCTTTTGCTAATCTTGGG No data
1144140520_1144140526 5 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140520_1144140528 7 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140528 17:12342834-12342856 TCTAGCTTTTGCTAATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140520 Original CRISPR ACTGCCCCCTGCTGGAGGGA TGG (reversed) Intergenic
No off target data available for this crispr