ID: 1144140526

View in Genome Browser
Species Human (GRCh38)
Location 17:12342832-12342854
Sequence CCTCTAGCTTTTGCTAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140519_1144140526 6 Left 1144140519 17:12342803-12342825 CCCATCCCTCCAGCAGGGGGCAG No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140522_1144140526 1 Left 1144140522 17:12342808-12342830 CCCTCCAGCAGGGGGCAGTAGGA No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140523_1144140526 0 Left 1144140523 17:12342809-12342831 CCTCCAGCAGGGGGCAGTAGGAA No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140524_1144140526 -3 Left 1144140524 17:12342812-12342834 CCAGCAGGGGGCAGTAGGAACCT No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140509_1144140526 27 Left 1144140509 17:12342782-12342804 CCTGAGACTCTGCCTCCTCCCCC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140510_1144140526 15 Left 1144140510 17:12342794-12342816 CCTCCTCCCCCCATCCCTCCAGC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140511_1144140526 12 Left 1144140511 17:12342797-12342819 CCTCCCCCCATCCCTCCAGCAGG No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140518_1144140526 7 Left 1144140518 17:12342802-12342824 CCCCATCCCTCCAGCAGGGGGCA No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140517_1144140526 8 Left 1144140517 17:12342801-12342823 CCCCCATCCCTCCAGCAGGGGGC No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140515_1144140526 9 Left 1144140515 17:12342800-12342822 CCCCCCATCCCTCCAGCAGGGGG No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
1144140520_1144140526 5 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140526 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140526 Original CRISPR CCTCTAGCTTTTGCTAATCT TGG Intergenic
No off target data available for this crispr