ID: 1144140529

View in Genome Browser
Species Human (GRCh38)
Location 17:12342857-12342879
Sequence TTGAATCATCATCTTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144140523_1144140529 25 Left 1144140523 17:12342809-12342831 CCTCCAGCAGGGGGCAGTAGGAA No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data
1144140524_1144140529 22 Left 1144140524 17:12342812-12342834 CCAGCAGGGGGCAGTAGGAACCT No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data
1144140525_1144140529 2 Left 1144140525 17:12342832-12342854 CCTCTAGCTTTTGCTAATCTTGG No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data
1144140522_1144140529 26 Left 1144140522 17:12342808-12342830 CCCTCCAGCAGGGGGCAGTAGGA No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data
1144140520_1144140529 30 Left 1144140520 17:12342804-12342826 CCATCCCTCCAGCAGGGGGCAGT No data
Right 1144140529 17:12342857-12342879 TTGAATCATCATCTTCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144140529 Original CRISPR TTGAATCATCATCTTCCACT TGG Intergenic
No off target data available for this crispr