ID: 1144141077

View in Genome Browser
Species Human (GRCh38)
Location 17:12348605-12348627
Sequence GTGAAATATACGACCTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144141076_1144141077 3 Left 1144141076 17:12348579-12348601 CCGTGGCTCTGAGATAATTAGAG No data
Right 1144141077 17:12348605-12348627 GTGAAATATACGACCTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144141077 Original CRISPR GTGAAATATACGACCTATTA TGG Intergenic
No off target data available for this crispr