ID: 1144142162

View in Genome Browser
Species Human (GRCh38)
Location 17:12360161-12360183
Sequence GTGGCCAATCCGACTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144142158_1144142162 28 Left 1144142158 17:12360110-12360132 CCTGCTGCTTGTCTCTCACTCTG No data
Right 1144142162 17:12360161-12360183 GTGGCCAATCCGACTGAGGTAGG No data
1144142159_1144142162 4 Left 1144142159 17:12360134-12360156 CCTACTTCACTGTATCTTACTGT No data
Right 1144142162 17:12360161-12360183 GTGGCCAATCCGACTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144142162 Original CRISPR GTGGCCAATCCGACTGAGGT AGG Intergenic
No off target data available for this crispr