ID: 1144142168

View in Genome Browser
Species Human (GRCh38)
Location 17:12360286-12360308
Sequence AGGGAGCAGGGGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144142168_1144142182 28 Left 1144142168 17:12360286-12360308 CCCTCCTCATTCCCCTGCTCCCT No data
Right 1144142182 17:12360337-12360359 TATACAGTTCTCTAGATAAGGGG No data
1144142168_1144142181 27 Left 1144142168 17:12360286-12360308 CCCTCCTCATTCCCCTGCTCCCT No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142168_1144142180 26 Left 1144142168 17:12360286-12360308 CCCTCCTCATTCCCCTGCTCCCT No data
Right 1144142180 17:12360335-12360357 AATATACAGTTCTCTAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144142168 Original CRISPR AGGGAGCAGGGGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr