ID: 1144142181

View in Genome Browser
Species Human (GRCh38)
Location 17:12360336-12360358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144142176_1144142181 3 Left 1144142176 17:12360310-12360332 CCTCCAAGTTCTTCTGTCCCGAG No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142175_1144142181 7 Left 1144142175 17:12360306-12360328 CCTGCCTCCAAGTTCTTCTGTCC No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142172_1144142181 15 Left 1144142172 17:12360298-12360320 CCCTGCTCCCTGCCTCCAAGTTC No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142177_1144142181 0 Left 1144142177 17:12360313-12360335 CCAAGTTCTTCTGTCCCGAGTAA No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142174_1144142181 8 Left 1144142174 17:12360305-12360327 CCCTGCCTCCAAGTTCTTCTGTC No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142171_1144142181 16 Left 1144142171 17:12360297-12360319 CCCCTGCTCCCTGCCTCCAAGTT No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142173_1144142181 14 Left 1144142173 17:12360299-12360321 CCTGCTCCCTGCCTCCAAGTTCT No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142169_1144142181 26 Left 1144142169 17:12360287-12360309 CCTCCTCATTCCCCTGCTCCCTG No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142170_1144142181 23 Left 1144142170 17:12360290-12360312 CCTCATTCCCCTGCTCCCTGCCT No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data
1144142168_1144142181 27 Left 1144142168 17:12360286-12360308 CCCTCCTCATTCCCCTGCTCCCT No data
Right 1144142181 17:12360336-12360358 ATATACAGTTCTCTAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144142181 Original CRISPR ATATACAGTTCTCTAGATAA GGG Intergenic
No off target data available for this crispr