ID: 1144146537

View in Genome Browser
Species Human (GRCh38)
Location 17:12404558-12404580
Sequence CAGGTGAGGAAACTGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146537_1144146547 13 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146537_1144146550 24 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146550 17:12404605-12404627 CCTCACCCAGGGTAAGAGCAGGG No data
1144146537_1144146548 23 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146537_1144146546 12 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146546 17:12404593-12404615 GTAGCTAGAAAACCTCACCCAGG No data
1144146537_1144146542 -10 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146542 17:12404571-12404593 TCCTCACCTGTAACCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146537 Original CRISPR CAGGTGAGGAAACTGTGGAG TGG (reversed) Intergenic