ID: 1144146538

View in Genome Browser
Species Human (GRCh38)
Location 17:12404563-12404585
Sequence GGTTACAGGTGAGGAAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146538_1144146553 29 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146538_1144146554 30 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146554 17:12404616-12404638 GTAAGAGCAGGGTCATCATAGGG No data
1144146538_1144146550 19 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146550 17:12404605-12404627 CCTCACCCAGGGTAAGAGCAGGG No data
1144146538_1144146546 7 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146546 17:12404593-12404615 GTAGCTAGAAAACCTCACCCAGG No data
1144146538_1144146547 8 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146538_1144146548 18 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146538 Original CRISPR GGTTACAGGTGAGGAAACTG TGG (reversed) Intergenic
No off target data available for this crispr