ID: 1144146542

View in Genome Browser
Species Human (GRCh38)
Location 17:12404571-12404593
Sequence TCCTCACCTGTAACCTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146534_1144146542 25 Left 1144146534 17:12404523-12404545 CCAATACAGAGGCTGAAAATTGG No data
Right 1144146542 17:12404571-12404593 TCCTCACCTGTAACCTGGGGAGG No data
1144146537_1144146542 -10 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146542 17:12404571-12404593 TCCTCACCTGTAACCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146542 Original CRISPR TCCTCACCTGTAACCTGGGG AGG Intergenic