ID: 1144146544

View in Genome Browser
Species Human (GRCh38)
Location 17:12404577-12404599
Sequence TAGCTACCTCCCCAGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146544_1144146553 15 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146544_1144146547 -6 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146544_1144146550 5 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146550 17:12404605-12404627 CCTCACCCAGGGTAAGAGCAGGG No data
1144146544_1144146548 4 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146544_1144146554 16 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146554 17:12404616-12404638 GTAAGAGCAGGGTCATCATAGGG No data
1144146544_1144146546 -7 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146546 17:12404593-12404615 GTAGCTAGAAAACCTCACCCAGG No data
1144146544_1144146555 17 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146555 17:12404617-12404639 TAAGAGCAGGGTCATCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146544 Original CRISPR TAGCTACCTCCCCAGGTTAC AGG (reversed) Intergenic
No off target data available for this crispr