ID: 1144146545

View in Genome Browser
Species Human (GRCh38)
Location 17:12404584-12404606
Sequence GGTTTTCTAGCTACCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146545_1144146553 8 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146545_1144146556 29 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146556 17:12404636-12404658 GGGGAAGACGAATTTGCGATTGG No data
1144146545_1144146555 10 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146555 17:12404617-12404639 TAAGAGCAGGGTCATCATAGGGG No data
1144146545_1144146548 -3 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146545_1144146550 -2 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146550 17:12404605-12404627 CCTCACCCAGGGTAAGAGCAGGG No data
1144146545_1144146554 9 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146554 17:12404616-12404638 GTAAGAGCAGGGTCATCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146545 Original CRISPR GGTTTTCTAGCTACCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr