ID: 1144146547

View in Genome Browser
Species Human (GRCh38)
Location 17:12404594-12404616
Sequence TAGCTAGAAAACCTCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146543_1144146547 -1 Left 1144146543 17:12404572-12404594 CCTCACCTGTAACCTGGGGAGGT No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146544_1144146547 -6 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146537_1144146547 13 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data
1144146538_1144146547 8 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146547 17:12404594-12404616 TAGCTAGAAAACCTCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146547 Original CRISPR TAGCTAGAAAACCTCACCCA GGG Intergenic
No off target data available for this crispr