ID: 1144146548

View in Genome Browser
Species Human (GRCh38)
Location 17:12404604-12404626
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146537_1144146548 23 Left 1144146537 17:12404558-12404580 CCACTCCACAGTTTCCTCACCTG No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146543_1144146548 9 Left 1144146543 17:12404572-12404594 CCTCACCTGTAACCTGGGGAGGT No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146545_1144146548 -3 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146544_1144146548 4 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data
1144146538_1144146548 18 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146548 17:12404604-12404626 ACCTCACCCAGGGTAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146548 Original CRISPR ACCTCACCCAGGGTAAGAGC AGG Intergenic
No off target data available for this crispr