ID: 1144146553

View in Genome Browser
Species Human (GRCh38)
Location 17:12404615-12404637
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144146543_1144146553 20 Left 1144146543 17:12404572-12404594 CCTCACCTGTAACCTGGGGAGGT No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146545_1144146553 8 Left 1144146545 17:12404584-12404606 CCTGGGGAGGTAGCTAGAAAACC No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146544_1144146553 15 Left 1144146544 17:12404577-12404599 CCTGTAACCTGGGGAGGTAGCTA No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data
1144146538_1144146553 29 Left 1144146538 17:12404563-12404585 CCACAGTTTCCTCACCTGTAACC No data
Right 1144146553 17:12404615-12404637 GGTAAGAGCAGGGTCATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144146553 Original CRISPR GGTAAGAGCAGGGTCATCAT AGG Intergenic
No off target data available for this crispr