ID: 1144152793

View in Genome Browser
Species Human (GRCh38)
Location 17:12466620-12466642
Sequence CACCTATCACACAAAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144152793_1144152798 19 Left 1144152793 17:12466620-12466642 CCTAGTTCTTTGTGTGATAGGTG No data
Right 1144152798 17:12466662-12466684 TTCTTTTTTAAGAAATGTGGTGG No data
1144152793_1144152797 16 Left 1144152793 17:12466620-12466642 CCTAGTTCTTTGTGTGATAGGTG No data
Right 1144152797 17:12466659-12466681 TCTTTCTTTTTTAAGAAATGTGG No data
1144152793_1144152799 22 Left 1144152793 17:12466620-12466642 CCTAGTTCTTTGTGTGATAGGTG No data
Right 1144152799 17:12466665-12466687 TTTTTTAAGAAATGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144152793 Original CRISPR CACCTATCACACAAAGAACT AGG (reversed) Intergenic
No off target data available for this crispr