ID: 1144153742

View in Genome Browser
Species Human (GRCh38)
Location 17:12477598-12477620
Sequence GACTTTGTAGCGGCCTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144153742_1144153747 -3 Left 1144153742 17:12477598-12477620 CCCATTTAGGCCGCTACAAAGTC No data
Right 1144153747 17:12477618-12477640 GTCCATTTTGGTATTTTGCTGGG No data
1144153742_1144153746 -4 Left 1144153742 17:12477598-12477620 CCCATTTAGGCCGCTACAAAGTC No data
Right 1144153746 17:12477617-12477639 AGTCCATTTTGGTATTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144153742 Original CRISPR GACTTTGTAGCGGCCTAAAT GGG (reversed) Intergenic
No off target data available for this crispr