ID: 1144157737

View in Genome Browser
Species Human (GRCh38)
Location 17:12523229-12523251
Sequence TGGTTAGAATGTCCTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144157737_1144157742 18 Left 1144157737 17:12523229-12523251 CCCAAGGCAGGACATTCTAACCA No data
Right 1144157742 17:12523270-12523292 TGTGATTAAATTTATACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144157737 Original CRISPR TGGTTAGAATGTCCTGCCTT GGG (reversed) Intergenic
No off target data available for this crispr