ID: 1144157742

View in Genome Browser
Species Human (GRCh38)
Location 17:12523270-12523292
Sequence TGTGATTAAATTTATACTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144157738_1144157742 17 Left 1144157738 17:12523230-12523252 CCAAGGCAGGACATTCTAACCAG No data
Right 1144157742 17:12523270-12523292 TGTGATTAAATTTATACTTAAGG No data
1144157741_1144157742 -2 Left 1144157741 17:12523249-12523271 CCAGTAGCTGGGATCTCGCAGTG No data
Right 1144157742 17:12523270-12523292 TGTGATTAAATTTATACTTAAGG No data
1144157737_1144157742 18 Left 1144157737 17:12523229-12523251 CCCAAGGCAGGACATTCTAACCA No data
Right 1144157742 17:12523270-12523292 TGTGATTAAATTTATACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144157742 Original CRISPR TGTGATTAAATTTATACTTA AGG Intergenic
No off target data available for this crispr