ID: 1144164712

View in Genome Browser
Species Human (GRCh38)
Location 17:12598834-12598856
Sequence TGTAAGCAAAATCTGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144164712_1144164716 6 Left 1144164712 17:12598834-12598856 CCTTTCAACAGATTTTGCTTACA No data
Right 1144164716 17:12598863-12598885 ATGAACATCCAAAGCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144164712 Original CRISPR TGTAAGCAAAATCTGTTGAA AGG (reversed) Intergenic
No off target data available for this crispr