ID: 1144164716

View in Genome Browser
Species Human (GRCh38)
Location 17:12598863-12598885
Sequence ATGAACATCCAAAGCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144164711_1144164716 7 Left 1144164711 17:12598833-12598855 CCCTTTCAACAGATTTTGCTTAC No data
Right 1144164716 17:12598863-12598885 ATGAACATCCAAAGCTACAAAGG No data
1144164712_1144164716 6 Left 1144164712 17:12598834-12598856 CCTTTCAACAGATTTTGCTTACA No data
Right 1144164716 17:12598863-12598885 ATGAACATCCAAAGCTACAAAGG No data
1144164710_1144164716 8 Left 1144164710 17:12598832-12598854 CCCCTTTCAACAGATTTTGCTTA No data
Right 1144164716 17:12598863-12598885 ATGAACATCCAAAGCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144164716 Original CRISPR ATGAACATCCAAAGCTACAA AGG Intergenic
No off target data available for this crispr