ID: 1144169080 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:12641326-12641348 |
| Sequence | TGCTAACTGAAAATAGATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144169080_1144169084 | 5 | Left | 1144169080 | 17:12641326-12641348 | CCACCATCTATTTTCAGTTAGCA | No data | ||
| Right | 1144169084 | 17:12641354-12641376 | GCATCACTGAACACAGAGTTGGG | No data | ||||
| 1144169080_1144169083 | 4 | Left | 1144169080 | 17:12641326-12641348 | CCACCATCTATTTTCAGTTAGCA | No data | ||
| Right | 1144169083 | 17:12641353-12641375 | GGCATCACTGAACACAGAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144169080 | Original CRISPR | TGCTAACTGAAAATAGATGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||