ID: 1144169080

View in Genome Browser
Species Human (GRCh38)
Location 17:12641326-12641348
Sequence TGCTAACTGAAAATAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144169080_1144169084 5 Left 1144169080 17:12641326-12641348 CCACCATCTATTTTCAGTTAGCA No data
Right 1144169084 17:12641354-12641376 GCATCACTGAACACAGAGTTGGG No data
1144169080_1144169083 4 Left 1144169080 17:12641326-12641348 CCACCATCTATTTTCAGTTAGCA No data
Right 1144169083 17:12641353-12641375 GGCATCACTGAACACAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144169080 Original CRISPR TGCTAACTGAAAATAGATGG TGG (reversed) Intergenic
No off target data available for this crispr