ID: 1144170898

View in Genome Browser
Species Human (GRCh38)
Location 17:12658985-12659007
Sequence TCACTTTAAGAGGGGTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144170898_1144170905 13 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data
1144170898_1144170907 23 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170907 17:12659031-12659053 GAAGAAGAAGAGGCCACACAGGG No data
1144170898_1144170908 24 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170908 17:12659032-12659054 AAGAAGAAGAGGCCACACAGGGG No data
1144170898_1144170906 22 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170906 17:12659030-12659052 CGAAGAAGAAGAGGCCACACAGG No data
1144170898_1144170903 -5 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170903 17:12659003-12659025 AGTGAGAGTAGCAAGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144170898 Original CRISPR TCACTTTAAGAGGGGTGAAG AGG (reversed) Intergenic
No off target data available for this crispr