ID: 1144170899

View in Genome Browser
Species Human (GRCh38)
Location 17:12658993-12659015
Sequence TGCTACTCTCACTTTAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144170899_1144170908 16 Left 1144170899 17:12658993-12659015 CCCCTCTTAAAGTGAGAGTAGCA No data
Right 1144170908 17:12659032-12659054 AAGAAGAAGAGGCCACACAGGGG No data
1144170899_1144170906 14 Left 1144170899 17:12658993-12659015 CCCCTCTTAAAGTGAGAGTAGCA No data
Right 1144170906 17:12659030-12659052 CGAAGAAGAAGAGGCCACACAGG No data
1144170899_1144170905 5 Left 1144170899 17:12658993-12659015 CCCCTCTTAAAGTGAGAGTAGCA No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data
1144170899_1144170907 15 Left 1144170899 17:12658993-12659015 CCCCTCTTAAAGTGAGAGTAGCA No data
Right 1144170907 17:12659031-12659053 GAAGAAGAAGAGGCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144170899 Original CRISPR TGCTACTCTCACTTTAAGAG GGG (reversed) Intergenic
No off target data available for this crispr