ID: 1144170905

View in Genome Browser
Species Human (GRCh38)
Location 17:12659021-12659043
Sequence CCAGGAAGACGAAGAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144170899_1144170905 5 Left 1144170899 17:12658993-12659015 CCCCTCTTAAAGTGAGAGTAGCA No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data
1144170900_1144170905 4 Left 1144170900 17:12658994-12659016 CCCTCTTAAAGTGAGAGTAGCAA No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data
1144170898_1144170905 13 Left 1144170898 17:12658985-12659007 CCTCTTCACCCCTCTTAAAGTGA No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data
1144170901_1144170905 3 Left 1144170901 17:12658995-12659017 CCTCTTAAAGTGAGAGTAGCAAG No data
Right 1144170905 17:12659021-12659043 CCAGGAAGACGAAGAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144170905 Original CRISPR CCAGGAAGACGAAGAAGAAG AGG Intergenic
No off target data available for this crispr