ID: 1144171762

View in Genome Browser
Species Human (GRCh38)
Location 17:12665516-12665538
Sequence AAGCCCGGCCGGGGAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144171748_1144171762 28 Left 1144171748 17:12665465-12665487 CCTTTGCAGCCGGCTGGCGGGAG No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171750_1144171762 19 Left 1144171750 17:12665474-12665496 CCGGCTGGCGGGAGATCCCGGCC No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171757_1144171762 -9 Left 1144171757 17:12665502-12665524 CCTTTCGCCGGCAGAAGCCCGGC No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171755_1144171762 -8 Left 1144171755 17:12665501-12665523 CCCTTTCGCCGGCAGAAGCCCGG No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171751_1144171762 3 Left 1144171751 17:12665490-12665512 CCCGGCCGCTTCCCTTTCGCCGG No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171753_1144171762 2 Left 1144171753 17:12665491-12665513 CCGGCCGCTTCCCTTTCGCCGGC No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data
1144171754_1144171762 -2 Left 1144171754 17:12665495-12665517 CCGCTTCCCTTTCGCCGGCAGAA No data
Right 1144171762 17:12665516-12665538 AAGCCCGGCCGGGGAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144171762 Original CRISPR AAGCCCGGCCGGGGAAGCCC CGG Intergenic