ID: 1144174419

View in Genome Browser
Species Human (GRCh38)
Location 17:12691288-12691310
Sequence CTGTGAAGAATGAGCGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144174417_1144174419 -1 Left 1144174417 17:12691266-12691288 CCAAGGAGACACATTTTCCACTC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG 0: 1
1: 0
2: 0
3: 17
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144174419 Original CRISPR CTGTGAAGAATGAGCGAGCA TGG Intronic
901865711 1:12105370-12105392 CTGTGAAGGATGAGGGAACGAGG - Intronic
903401961 1:23060145-23060167 CTGAGCAGAATGAGAGAGAAAGG + Intronic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906507908 1:46393834-46393856 CGGTGAAGAATGAGTGAGGGAGG + Intergenic
911269113 1:95778996-95779018 CTGTGAATAATGAGTTAGAAAGG - Intergenic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
919135424 1:193501805-193501827 ATGGGAAGAATGAGAGAGCAAGG + Intergenic
919775892 1:201193852-201193874 CTGGGAAGAAAGAGTGAGAAAGG - Intronic
920939570 1:210468998-210469020 CTATGAGGATTGAGCGAGCCTGG + Intronic
924752248 1:246904928-246904950 ATTTGAAGAATAAGAGAGCAGGG + Intronic
1064012294 10:11744129-11744151 CTGTTAAGAATTAGGGATCATGG - Intronic
1065801170 10:29353996-29354018 CTGGGAAGGTTGAGAGAGCAAGG - Intergenic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1073877408 10:107940890-107940912 CAGTAAAGAATGAGGGAGAAGGG + Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1076200688 10:128555390-128555412 CTGAGAAGGCTGAGCCAGCATGG + Intergenic
1080134099 11:28833866-28833888 CAGAGAGGAATGAGAGAGCATGG + Intergenic
1080896472 11:36452530-36452552 CTGGGAGGAATGAGTGAGGAAGG - Intronic
1087726648 11:101725833-101725855 GTGAGAAGAATGAGAGAGTAGGG + Intronic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1093229537 12:16526762-16526784 CTGTGAAAAGTGAGCCAGGAAGG + Intronic
1101389332 12:104286270-104286292 CAGGGAAGCATGAGAGAGCATGG + Intronic
1104004699 12:124883831-124883853 TGGGGAAGAAGGAGCGAGCAAGG - Intergenic
1105775203 13:23653443-23653465 CTGTGAAGGAAGAGAAAGCAGGG + Intronic
1109641652 13:65199524-65199546 CTGTGAAGTAAGAGCTATCATGG - Intergenic
1111777473 13:92682873-92682895 CTGGGAAGAATGTGGGAGTAGGG + Intronic
1114042988 14:18695986-18696008 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114047279 14:18886426-18886448 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114116936 14:19632971-19632993 CTGAGAAGAAGGAGCGAGCTGGG - Intergenic
1119830553 14:77698207-77698229 TTGTGAAGAAAGAGCCAACAGGG + Intronic
1120192306 14:81450367-81450389 GTGGGAAGAATGAGAGTGCAGGG + Intergenic
1121436672 14:93925186-93925208 CAGTGCAGAATGGGCCAGCAGGG + Exonic
1123727076 15:23113805-23113827 CTGTCAAGAATCAGCGAGCTTGG - Intergenic
1124616668 15:31247213-31247235 TTGGGAAGAGTGAGGGAGCAAGG + Intergenic
1124972659 15:34504434-34504456 CTGGGAAGAATGTGGGAGCAGGG + Intergenic
1127495540 15:59508130-59508152 TTTTGAAGAATGAGTGAGAATGG + Intronic
1128381618 15:67117317-67117339 CTGTGATGAATGAGCAGGCATGG + Intronic
1130090982 15:80821195-80821217 CTCAGAGGAATGAGGGAGCAGGG + Intronic
1132516119 16:366800-366822 CTCTGAAGAATGTTCGAGAAGGG + Intergenic
1133033146 16:3021093-3021115 CTGTGAGGAATGCGCGGGGAGGG + Intronic
1139002911 16:62535960-62535982 CTGAGAAGAGTGAGAGAGAAAGG + Intergenic
1141148070 16:81545849-81545871 CTCGGCTGAATGAGCGAGCACGG + Intronic
1141435280 16:83996361-83996383 CAGTGCAAAATGAGCGTGCAAGG + Intronic
1143552027 17:7636266-7636288 CTGTGGAGTGTGAGCCAGCAGGG + Intergenic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1144391797 17:14800459-14800481 CTGTGAAGAATGAGCCACGCAGG - Intergenic
1146305125 17:31724698-31724720 TTATCAAGAATGAGCCAGCAGGG + Intergenic
1148078415 17:44953472-44953494 CTTTAAAGAATGAGCAAGCATGG + Intergenic
1148535812 17:48437834-48437856 CTGTTTAGAATGAGTGAGGAAGG - Intergenic
1149306369 17:55350615-55350637 AAGTGAAGTATGAGTGAGCAAGG + Intergenic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1153718931 18:7881600-7881622 CTCTGAAGAAAGAGAGAGCAGGG - Intronic
1157652067 18:49343287-49343309 CTGAGCAGAATGAGCAAGGATGG - Intronic
1158358654 18:56648138-56648160 CTCTGATGAATGACTGAGCAGGG - Intronic
1162304511 19:9863672-9863694 CTGTGAATTATGAGCGATCCCGG + Intronic
1164481221 19:28612398-28612420 CTGGGAAGAATAAGCTAACAGGG - Intergenic
1165700379 19:37932838-37932860 CTGTGAAGAAAGAGTGGGCCGGG + Intronic
1167429420 19:49446097-49446119 CTGTGAAGAAGGAAAGTGCAGGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931245886 2:60492518-60492540 ATGTGAGGAAGGAGAGAGCAAGG - Intronic
932256212 2:70289514-70289536 CTGTAAAGAGTGAGGGAGTAGGG + Intronic
933185822 2:79278340-79278362 CGGGGAAGAAGGAGCGAGCATGG + Intronic
938424658 2:131174972-131174994 CTGAGAAGAAGGAGAGAGCTGGG + Intronic
942624568 2:177885858-177885880 CTGTGAAGCATAAGCTAGCTAGG - Intronic
946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG + Intergenic
946792740 2:223317995-223318017 CTGTGAAACATGAATGAGCAAGG - Intergenic
949072710 2:242035613-242035635 GGGTGAAGAAGGAGCGGGCAGGG + Intergenic
1173657026 20:44706547-44706569 CTGGCAAGGATGAGCGTGCAGGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1179350693 21:40607975-40607997 CAGTGAAGAGTGAGTGAGGAAGG + Intronic
1180075564 21:45459760-45459782 CTGCCAAGAGTGAGCGAGCGGGG + Intronic
1180465812 22:15609081-15609103 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1184057228 22:42060638-42060660 CTGTGAGGAACGTGCCAGCAAGG + Intronic
953557328 3:43956867-43956889 CAGAGAAGAATGAAAGAGCAGGG + Intergenic
953557338 3:43956913-43956935 CAGAGAAGAATGAAGGAGCAGGG + Intergenic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
955924856 3:63994878-63994900 CTGTTAAGAATGTGTGGGCAAGG - Intronic
957742753 3:84293499-84293521 ATGTGAAGAAGTAGCAAGCAAGG + Intergenic
958707861 3:97678449-97678471 CTGTGGTGAATGACAGAGCAGGG + Intronic
960584035 3:119304280-119304302 CTGTAGAGGATGAGCAAGCAGGG + Intronic
961215570 3:125157637-125157659 ATGTGAAGACTCAGCGCGCATGG - Intronic
961962852 3:130869734-130869756 CTGTGAAGGTTGAGAGAGGAGGG + Intronic
963119674 3:141765406-141765428 CTGTGAAGAAAAATCAAGCAGGG - Intergenic
965596720 3:170418495-170418517 CAGGGAAGAAGGAGCGAGCAGGG + Intergenic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
969910737 4:10443230-10443252 CTGTGAAGAATCATCAGGCAAGG + Exonic
975834218 4:78404634-78404656 CTGTGAAGGATGACAGAGGAAGG - Intronic
976685115 4:87805100-87805122 ATCTGAAGAATGAGCCAGCAGGG + Intronic
978737377 4:112099261-112099283 CTGTCAGGAATGATCCAGCAAGG + Intergenic
982987448 4:162229148-162229170 CTTTGAAGAATGTGCTAGCAGGG + Intergenic
984816278 4:183839993-183840015 CTGTGAACACTCAGCGTGCAAGG + Intergenic
985954359 5:3252190-3252212 CTGTGAAGACTTAGAGAGCCTGG + Intergenic
986714553 5:10513516-10513538 ATGTGAAGAAAGAGCCAGCCTGG + Intronic
987246758 5:16056858-16056880 GTGTAAGGAGTGAGCGAGCAGGG - Intergenic
988619310 5:32806246-32806268 CTTAGAAGAATCAGCCAGCAAGG - Intergenic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
997837419 5:137207000-137207022 CTGTGAAGAATATGAGAGTAAGG + Intronic
998915874 5:147010911-147010933 GTGTGAAGAATGTTTGAGCAGGG - Intronic
1001851772 5:174973935-174973957 CTGTGACGAGTGAGAGAACACGG - Intergenic
1002902263 6:1418936-1418958 CTGTGAAGAATCAGCTAGTGAGG + Intergenic
1003782176 6:9441838-9441860 ATGGGAAGAAGGAGTGAGCAGGG + Intergenic
1004973216 6:20935362-20935384 ATGAGAAGAATGAGGGAGTAAGG - Intronic
1006665769 6:35691973-35691995 CAGTGAAAAATGAGAGTGCAGGG - Intronic
1008448460 6:51621230-51621252 CTGGGCATAATGAGGGAGCAAGG - Intronic
1011444735 6:87426095-87426117 CTGTTAGGAGTGAGCCAGCAGGG - Intronic
1014006565 6:116426062-116426084 CTGTGCAGATTGAGAGATCATGG + Intronic
1018317881 6:162575345-162575367 CTGTGTAGAATGAGCAATAAAGG - Intronic
1023068480 7:36403407-36403429 CTGTGAAGGATAAGCCAGGAAGG + Intronic
1024524329 7:50335958-50335980 CTGTGAAGCCTGACCCAGCAGGG + Intronic
1024798334 7:53045982-53046004 CTATGAAGAAAAAGAGAGCAAGG - Intergenic
1025120525 7:56297905-56297927 GTGTGAAGAGGGAGAGAGCAGGG - Intergenic
1032467080 7:132152926-132152948 CTTTGATGAATGAGTGAGCGTGG - Intronic
1035967413 8:4209090-4209112 CTGTAAATCATCAGCGAGCAAGG - Intronic
1036596487 8:10217582-10217604 CTGTGGAAGCTGAGCGAGCAAGG - Intronic
1037779971 8:21861238-21861260 CCGTCAAGAATCATCGAGCATGG + Intergenic
1042166134 8:65947901-65947923 GTGTGATGAATGAGAGGGCAAGG - Intergenic
1042337963 8:67648353-67648375 CTTTGAGGAATGAGAGAGAAGGG + Intronic
1042906376 8:73776403-73776425 CTGTGAAGACTGAGAGGGTAGGG + Intronic
1043128254 8:76427785-76427807 CTGTGAGGAATTAGGAAGCAGGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045069614 8:98488197-98488219 CTGTGAAGAATGGTGAAGCATGG + Intronic
1048883434 8:138888778-138888800 CTGTGAAGCATGAGAGGGCTGGG - Intronic
1051197875 9:14583417-14583439 CTGAGAAGAATGAGCAAAAAGGG + Intergenic
1052060518 9:23954954-23954976 CTGTGAAGACTGAGAGGGTAAGG + Intergenic
1052764444 9:32626456-32626478 ATGTGAAGAATGGGGGAGGAGGG - Intergenic
1053232299 9:36420584-36420606 TTGTGAAGAATAAGAAAGCAGGG - Intronic
1058368519 9:104236522-104236544 CTGTGAACACTGAGTTAGCAGGG - Intergenic
1058618869 9:106862981-106863003 CTCTGAATAATGAGCAACCAGGG - Intergenic
1059388168 9:113981414-113981436 ATGTGCACAATGAGTGAGCAGGG - Intronic
1060235004 9:121856689-121856711 CTGTGAAGAATGATAGAGCCTGG - Intronic
1061070801 9:128309460-128309482 CTGTGCAGAAAGTGAGAGCAGGG - Exonic
1061940683 9:133882287-133882309 CTGTGAAGGCTGAGCGGACAGGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187296718 X:18009607-18009629 CTATGAATGATGAGCGTGCAGGG + Intergenic
1187666109 X:21611532-21611554 ACCTGAAGAATGAGCAAGCATGG - Intronic
1189185272 X:39049453-39049475 ATCTGAAGAATGAGGGAGCTGGG - Intergenic
1195577700 X:106468899-106468921 CTGTGTCTAATGAGTGAGCAAGG + Intergenic