ID: 1144174699

View in Genome Browser
Species Human (GRCh38)
Location 17:12694002-12694024
Sequence TCTTATCTTTGGAAGGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144174699_1144174704 -5 Left 1144174699 17:12694002-12694024 CCCACGACCTTCCAAAGATAAGA 0: 1
1: 0
2: 2
3: 6
4: 95
Right 1144174704 17:12694020-12694042 TAAGAATGAGGTCCCCAAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 173
1144174699_1144174708 17 Left 1144174699 17:12694002-12694024 CCCACGACCTTCCAAAGATAAGA 0: 1
1: 0
2: 2
3: 6
4: 95
Right 1144174708 17:12694042-12694064 GTGAATGAAGAGAAAACTCCAGG 0: 1
1: 0
2: 0
3: 31
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144174699 Original CRISPR TCTTATCTTTGGAAGGTCGT GGG (reversed) Intronic
903764183 1:25722978-25723000 TCTTTTCTGTGGAAGCTTGTAGG + Intronic
906259146 1:44373226-44373248 TCTAATCATTGGAAGGCAGTAGG + Intergenic
908567046 1:65368130-65368152 ACTTATCTTTAGAACGTCCTGGG - Intronic
908587227 1:65583197-65583219 TCTTATCTCTGCAAGATTGTTGG - Intronic
911040173 1:93585035-93585057 TCTTATCTTCGAAAGGTTGCTGG - Intronic
920827769 1:209437805-209437827 TCTCATCTCTGAAAGGTCTTGGG - Intergenic
921555262 1:216591180-216591202 TCTTCTCTTTGGAAGTTGATGGG - Intronic
923421217 1:233817252-233817274 TCTTATCTCTGTGAGGTAGTTGG + Intergenic
924071569 1:240285549-240285571 TCTCATTTTTGGAATGTCCTAGG - Intronic
924223278 1:241900006-241900028 GCTTATCTATGGAAGGCCGGTGG + Intergenic
1065257743 10:23889935-23889957 TCATATCTTTAGCAGGTTGTAGG + Intronic
1068772154 10:60834015-60834037 TCCTTTCTTTGGAAGGTACTCGG + Intergenic
1072619821 10:97072548-97072570 TCTTATCTCTTGATGGCCGTTGG - Intronic
1079615045 11:22481753-22481775 TCCTATGTTGGGAAGGTGGTAGG - Intergenic
1079792814 11:24760325-24760347 GGTTAACTTTGGAATGTCGTTGG + Intronic
1080719322 11:34833968-34833990 TCTTTTCTTTGGCAGGGGGTGGG - Intergenic
1080719580 11:34836397-34836419 TCTTCTCTTTGGCAGGGGGTAGG - Intergenic
1094183778 12:27619165-27619187 TGATATCTGTGGGAGGTCGTGGG - Intronic
1099315398 12:81077688-81077710 TTTAATCTTTGGAAGGTCGTTGG - Exonic
1108587151 13:51880194-51880216 GCTTATTTTTGGAAAGTAGTAGG + Intergenic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1111018773 13:82417993-82418015 TCTTCTCTTTGGAAGGGTGTGGG + Intergenic
1114839003 14:26240315-26240337 TCTTATCTTTGGAAGGATTCTGG - Intergenic
1116174333 14:41447848-41447870 TCTTCTCTTCTGAAGATCGTGGG - Intergenic
1119120416 14:72070576-72070598 TCCTATCTTTGGCAGGCCCTGGG + Intronic
1119493251 14:75055939-75055961 TTTTATCTTTGTAAGGTTGGTGG - Intronic
1120780520 14:88481946-88481968 TCTTCTCTCTGGAATGTTGTTGG - Intronic
1122490462 14:102111936-102111958 TCTTCTCTCTGGAAGCTTGTAGG + Intronic
1124167657 15:27342541-27342563 TCTTTTCTCTGGAAGGTCTGTGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1133942189 16:10318828-10318850 TCTTATCTGTGCAAGGCCCTGGG - Intergenic
1134500928 16:14768669-14768691 TCTGTTCTGTGGAAGGTTGTGGG - Intronic
1134579654 16:15360380-15360402 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1134715050 16:16353818-16353840 TCTGTTCTGTGGAAGGTTGTGGG - Intergenic
1134722928 16:16397179-16397201 TCTGTTCTGTGGAAGGTTGTGGG - Intergenic
1134944500 16:18314692-18314714 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1134951765 16:18354841-18354863 TCTGTTCTGTGGAAGGTTGTGGG + Intergenic
1137706697 16:50540325-50540347 TCTCATCTTTGCAAGGCCATGGG + Intergenic
1138768122 16:59628624-59628646 TCTTGTCTTTGGAAGGGCAATGG + Intergenic
1144174699 17:12694002-12694024 TCTTATCTTTGGAAGGTCGTGGG - Intronic
1148488697 17:48009071-48009093 CCTCATCCTTGGAAGGTGGTGGG + Intergenic
1149257033 17:54837935-54837957 GTTTATCTTTGGCAGGTTGTGGG + Intergenic
1162242177 19:9363856-9363878 TCTAATGTTTCGGAGGTCGTAGG - Intronic
1163675064 19:18651575-18651597 TGTTGTCTTTGGAAGGTGCTGGG + Intronic
1167707601 19:51090768-51090790 TCCTATCTTTGGAAGCTGGGGGG + Intergenic
925169031 2:1739806-1739828 ATTTATCTTTGCAAGGTGGTGGG - Intronic
927216075 2:20668386-20668408 TCTTACCTTTGGAAGGCCCAGGG - Intronic
928152040 2:28839818-28839840 TCTTAACTTTGGAATGTATTGGG - Intronic
928687702 2:33766272-33766294 TCTTATGTTTGACAGGTTGTTGG + Intergenic
928790167 2:34940544-34940566 TGTTACCTTTGGGAGGTCATTGG - Intergenic
937502614 2:122496923-122496945 TCTTATTTGTGCAAGGTTGTTGG + Intergenic
940497255 2:154447744-154447766 TCTTACATTTGGAATGTCTTTGG - Intronic
941321722 2:164063909-164063931 TCTTACCTTTGGCAGGAAGTGGG + Intergenic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
943418869 2:187641326-187641348 TCTTTTGTTTGGAAGTGCGTTGG + Intergenic
1169382865 20:5123816-5123838 TCTTATGTTTGGAAGCCCATAGG - Intronic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1177434345 21:21031447-21031469 TCTTAGATTTGGGAGGTGGTTGG - Intronic
1180922389 22:19527657-19527679 GCTTATCCTTGGAAGGTCACGGG - Intergenic
1183336480 22:37250397-37250419 GCTTAGCTTTGGAAGGTTCTTGG - Intergenic
949189198 3:1231267-1231289 TCTTATCTATGGGAGTTCATGGG - Intronic
950622848 3:14219986-14220008 TTTTATTTCTGTAAGGTCGTTGG + Intergenic
951984839 3:28607545-28607567 TCTTCTCTTTGGAAGCTTTTAGG - Intergenic
955837124 3:63068363-63068385 TCTTATCTTTGGGAAGGAGTTGG + Intergenic
960700785 3:120437299-120437321 TCTTATTTTTGGAATATGGTAGG + Intronic
962347341 3:134627818-134627840 TCTGATCTTTGGAATATTGTAGG - Exonic
962821769 3:139055253-139055275 TCTTTTCTTTGGAAAATAGTGGG + Intronic
964821006 3:160769396-160769418 TCTTATTTTTGGATTGTCTTAGG + Intronic
966765944 3:183462876-183462898 TCTTATCTTGGAAAGTTCATAGG - Intergenic
967545679 3:190724303-190724325 TCTTTTCTTTCAAAGGTCTTTGG - Intergenic
969519978 4:7671159-7671181 TCTTATTTTTTGATGGTTGTTGG - Intronic
978477721 4:109150304-109150326 TCTTAAGTTTCTAAGGTCGTTGG + Intronic
978702567 4:111666120-111666142 TCTTATCTTTTGATGGTGATTGG - Intergenic
979007993 4:115327918-115327940 TCCTATATTTGGAGGATCGTTGG - Intergenic
979572384 4:122243416-122243438 GCCTGTCTTTGGAAGGTCTTTGG + Intronic
983030633 4:162797314-162797336 TGTTATCTTAGGAAGCTCCTAGG + Intergenic
984479518 4:180281203-180281225 GCTTCTCTTTGGTAGGTAGTGGG + Intergenic
994406354 5:99350675-99350697 AGTTATCATTGGAATGTCGTTGG - Intergenic
998366398 5:141635361-141635383 TATTATCTTTGGAAGGTCAGGGG + Intronic
999958549 5:156728601-156728623 TCTTATCTTGGGGTGGTGGTGGG - Intronic
1006905000 6:37527270-37527292 TCTTTTCTGTGGAAGGACATTGG - Intergenic
1011990238 6:93506598-93506620 TGTTTTCTTTTGAAAGTCGTGGG - Intergenic
1013240360 6:108239626-108239648 TCTTCTCTTTTGAATGTCTTCGG - Intronic
1014906246 6:127032162-127032184 TCTTATCTTAAGAAAGTAGTTGG - Intergenic
1020237560 7:6368117-6368139 TTTTCTCTTTGGAAGCTTGTAGG + Intergenic
1021441644 7:20684327-20684349 TCTTTTCTTGAGAAGGTCGCTGG - Intronic
1023652506 7:42386864-42386886 CCTAACCTTTGGAAGCTCGTAGG + Intergenic
1026041165 7:66869309-66869331 TCTTTTCTTTGGAAGTTACTTGG - Intergenic
1029788378 7:102816511-102816533 TCTTCTCTTGGCAAGGTCCTGGG - Intronic
1030149880 7:106393378-106393400 TCTTCTCACTGGAAGGTCTTCGG - Intergenic
1031384050 7:121124457-121124479 TTTTACCTATGGAAGGTCTTTGG - Exonic
1031785797 7:126029663-126029685 TCTTACCTTTGGAATCTTGTAGG + Intergenic
1033682047 7:143604389-143604411 TCTAATCTTAGGAAGGGCCTTGG - Intergenic
1033702842 7:143857524-143857546 TCTAATCTTAGGAAGGGCCTTGG + Intronic
1034088279 7:148339825-148339847 TCTTCTCTCTGCAAGGTCGGGGG + Intronic
1039796550 8:40920279-40920301 TCTCATCTTTGGATGGTCAGCGG + Intergenic
1042515989 8:69659590-69659612 TATTATCTTTTGAATATCGTAGG + Exonic
1044116250 8:88337962-88337984 TCTAATCTTTGCAAAGTCCTCGG - Intergenic
1049841336 8:144774714-144774736 TCTTATCTTTGCAAGGCTGTTGG - Intronic
1051503936 9:17807553-17807575 TATTATCTTTGGAAGGTCCTTGG + Intergenic
1056413102 9:86351563-86351585 TTTTATCTTTACAAGGTCTTAGG - Intronic
1191178210 X:57529366-57529388 TCTCATCTTTCTCAGGTCGTGGG + Intergenic
1197291283 X:124661588-124661610 TCTTAACTTTGGATGGTGGCAGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic