ID: 1144175179

View in Genome Browser
Species Human (GRCh38)
Location 17:12698400-12698422
Sequence ACCAAGTTCTTGAGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144175179 Original CRISPR ACCAAGTTCTTGAGGTGAGA GGG Intronic
903439072 1:23373741-23373763 ACCTAGTTCATGAGGTCAGAGGG + Intergenic
904300675 1:29551384-29551406 ACCAAATGCCTGAGGTGAGTGGG + Intergenic
904857690 1:33511350-33511372 ATCAGGTTATTGAGGTGACAAGG + Intergenic
906142768 1:43543610-43543632 TCAAAGTTCATGAGGTCAGAAGG - Intronic
906524222 1:46485260-46485282 AGCAAGTTCTCGAGGTGAGAAGG + Intergenic
907283286 1:53364567-53364589 TCCAACTCCTTGAGGTGTGAGGG - Intergenic
908518744 1:64919928-64919950 AGCAGGTGCTGGAGGTGAGAAGG - Intronic
912170455 1:107093091-107093113 ACCAAGTACTTGGGGTAAGATGG + Intergenic
912496094 1:110092681-110092703 ACAAAGTCCCTGAGGTGGGACGG - Intergenic
912651266 1:111441723-111441745 ACGCAGTTCTTTATGTGAGAGGG + Intronic
915099174 1:153486108-153486130 GCCAAGTTGATGAGGTGAGGTGG - Intergenic
915140312 1:153763873-153763895 ACCAGGTCCTGGAGGTGAGGAGG + Exonic
915971331 1:160357240-160357262 GCAAAGAGCTTGAGGTGAGATGG + Exonic
916085950 1:161269609-161269631 GCCAAGGTCCTGAGGTGGGAAGG + Intronic
916963326 1:169910699-169910721 AATCATTTCTTGAGGTGAGAGGG - Intergenic
918023944 1:180724049-180724071 CCCAATTTCTGGAGATGAGAAGG + Intronic
923451930 1:234126054-234126076 ACCCAGTTCATGAGTTGTGATGG + Intronic
1067743821 10:48917734-48917756 AGGAAGTTCTTCAGGTGAAAGGG + Intronic
1070824719 10:79384468-79384490 TCCAAGGTGTTGAGGTGAGCTGG - Exonic
1071895729 10:90064641-90064663 AGCAAGTTCTTCAGATGGGAAGG - Intergenic
1071945325 10:90637523-90637545 AACAACTTCTTCAGGTGAGAAGG + Intergenic
1072243416 10:93519153-93519175 AACAGATTCTTGAGGTGTGATGG + Intronic
1073322623 10:102624874-102624896 AACAAGTGCTGGGGGTGAGATGG - Intronic
1073375145 10:103027446-103027468 AACTACTTCTAGAGGTGAGAGGG + Intronic
1073452711 10:103619090-103619112 ACCAAGTTCTGCAGCAGAGAAGG - Intronic
1075028220 10:119002664-119002686 ACCCAGTGCCTGAGGTGAGCTGG + Intergenic
1078709607 11:13778340-13778362 ACCAAATTCCTTAGGTGAGTGGG + Intergenic
1079661033 11:23036827-23036849 ACCTAGTTCTGGTGGTGAGAAGG + Intergenic
1080266306 11:30405522-30405544 ACAAAAATCTTGAGGTGAAAAGG - Intronic
1080504945 11:32903329-32903351 ACCAAGATCCTGAGGTGAATGGG + Intronic
1081378969 11:42391794-42391816 ACCAAGTCCTTGAGGTGGGAAGG - Intergenic
1083923186 11:65791357-65791379 GCCCAGTTCTGAAGGTGAGACGG - Intronic
1084475818 11:69388555-69388577 AGCAAGTGTTGGAGGTGAGATGG + Intergenic
1085647877 11:78239684-78239706 ACGAAGTTCTTTTGGTGAGAAGG + Intronic
1086947407 11:92856770-92856792 TCCAAGTTCTTGAGGGCAGGAGG + Intronic
1086970247 11:93073703-93073725 GCAAAGGTCCTGAGGTGAGAGGG - Intergenic
1091476980 12:784373-784395 ACCAACTTCTTGAGATGGTAGGG - Intronic
1099423803 12:82498366-82498388 ATCAAGTTCTTGAGGTCTGTAGG - Intergenic
1100492920 12:95098565-95098587 ACAAAGGTCCTTAGGTGAGAAGG - Intronic
1103368787 12:120402601-120402623 AGCATGTTCTTCAGCTGAGAGGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104520430 12:129469452-129469474 ACCAAGACCTTCAGGTGATATGG + Intronic
1104639100 12:130456044-130456066 AACAAGTTACTGAGATGAGAAGG + Intronic
1105909485 13:24848707-24848729 AAAAAGTTCTTGAGATGAAATGG - Intronic
1109174716 13:59141096-59141118 ACCTATTTCTAAAGGTGAGATGG - Intergenic
1110832531 13:80047603-80047625 AGAAGGTTCTTGTGGTGAGACGG - Intergenic
1111960697 13:94806887-94806909 ACCAAGTGCTTGTGTTTAGAGGG + Intergenic
1114419119 14:22565463-22565485 ACAAATTCTTTGAGGTGAGAGGG + Intronic
1115941749 14:38617959-38617981 ACCAAGTTCTTCATGTGGGAAGG - Intergenic
1119146337 14:72318173-72318195 TCCAAGTTCTTGGGCTGAGGTGG - Intronic
1120295229 14:82631783-82631805 AATAAGTCCTTGAAGTGAGATGG + Intergenic
1124022679 15:25938796-25938818 ACCAAGTTTTGGAGGGGGGAGGG + Intergenic
1125186698 15:36939175-36939197 AGCCAGTTATTGAGGTGAGAGGG - Intronic
1126195678 15:45927763-45927785 TCCAAGTTCTTATGGAGAGAGGG + Intergenic
1126237883 15:46406953-46406975 AGCAAGTTGGTGGGGTGAGAAGG - Intergenic
1126674168 15:51144912-51144934 ACAAAGGTCTGGAGGGGAGAAGG + Intergenic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128938146 15:71765512-71765534 AGCAAGTTCCTGAGGTGTGTTGG + Intronic
1132140010 15:99384615-99384637 TCCAAGTTTGTGGGGTGAGATGG - Intronic
1135659092 16:24278992-24279014 ACCAAGGTCTGGAGGCTAGATGG + Intronic
1136573983 16:31112441-31112463 TCCAAGTTCTGGAGGCGAGGAGG - Exonic
1138503066 16:57460580-57460602 GTCAAGTTCTTGAGCTGACACGG - Exonic
1138907015 16:61349237-61349259 ACCAAGGCCCTGAGTTGAGAGGG - Intergenic
1143614467 17:8041501-8041523 ACCAAGATCTCTATGTGAGAGGG + Intronic
1144175179 17:12698400-12698422 ACCAAGTTCTTGAGGTGAGAGGG + Intronic
1144363619 17:14520658-14520680 ACCAATTTATTGAGGTGCTAAGG + Intergenic
1146596813 17:34176589-34176611 AACAATTGCTTGAGGAGAGATGG - Intergenic
1152393385 17:80016567-80016589 GCCAAGTGCTGGAGGTGAAAGGG - Intronic
1153381453 18:4444241-4444263 ACATATTTCTTAAGGTGAGATGG - Intronic
1153544889 18:6195262-6195284 GCCATGTTCTGGAGGAGAGAAGG + Intronic
1156030184 18:32704269-32704291 CCCAAGTTATTGAGGGCAGAAGG + Intronic
1158504523 18:58034747-58034769 TTAAAGATCTTGAGGTGAGAGGG + Intergenic
1164587172 19:29483353-29483375 ACCAAGGACTGGAGGTGAGCAGG + Intergenic
1164758296 19:30707419-30707441 ACCAAGCCCTTAAGGTGAAAAGG + Intronic
1164870888 19:31641746-31641768 ACCACGTTCTTGTGGCCAGAGGG - Intergenic
1165147434 19:33740254-33740276 CCCAAGCTCTTAGGGTGAGAGGG + Intronic
1165950647 19:39472480-39472502 CCCCAGTGCTGGAGGTGAGAGGG + Exonic
926011024 2:9407949-9407971 ACCAATTTCTTAAGGTGAATAGG - Intronic
930562421 2:52976598-52976620 ACAAAGTTTTTAGGGTGAGATGG + Intergenic
930817329 2:55611839-55611861 AGCTACTTCTGGAGGTGAGACGG - Intronic
931216840 2:60253072-60253094 ACCCCTTTCTTGAAGTGAGAAGG - Intergenic
933764833 2:85699614-85699636 ACCAAGTGATTGGGTTGAGATGG - Intergenic
934040537 2:88124442-88124464 TCCCAGTGCTTGAGGGGAGAGGG - Intronic
935341329 2:102062178-102062200 AGCAAGCTCATGAGGAGAGATGG - Intergenic
937831585 2:126430229-126430251 CTCAAGTCCTTGAGGTGAGGAGG + Intergenic
940518120 2:154707226-154707248 ATCAAGTATTTGAGGTGGGAGGG + Intronic
941065049 2:160892446-160892468 ATCAAGTTCTTGAGGGGAGGAGG - Intergenic
942264277 2:174205522-174205544 CCCTAGTTCCTGAGGTGAAAAGG - Intronic
947790287 2:232862618-232862640 TCCAAGTTCTTTAGGTGATCTGG - Intronic
948002122 2:234576853-234576875 ACAAGGTGCTTGAGGTGAGGTGG - Intergenic
1169073944 20:2750252-2750274 ACAATGTTCAGGAGGTGAGATGG - Intronic
1170485863 20:16816009-16816031 ACCATGTTCTTAAAGTGAGATGG - Intergenic
1170735499 20:19010829-19010851 TCCAAGTTTTGGGGGTGAGAAGG + Intergenic
1171381738 20:24738641-24738663 ACCAAGGTCCTGATGTGAGGAGG + Intergenic
1172221331 20:33276967-33276989 ACCAGGGGCTGGAGGTGAGATGG - Intronic
1172812287 20:37657253-37657275 TCCAAGTTCTTCAGCTGAGGAGG - Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174964184 20:55192839-55192861 ACAAAGTCCCTGTGGTGAGAGGG - Intergenic
1175641840 20:60636653-60636675 ACGAAGTTCTTGATGTGACAAGG + Intergenic
1176408968 21:6437486-6437508 ACCAAGTGCCTGAGGAGAGTTGG + Intergenic
1179684461 21:43045808-43045830 ACCAAGTGCCTGAGGAGAGTTGG + Intergenic
1181614739 22:24045850-24045872 AACAAGAACTGGAGGTGAGAAGG - Intronic
1182079901 22:27521641-27521663 AACAAGGCCTTGAGCTGAGAAGG - Intergenic
950631652 3:14285967-14285989 CACAAGATGTTGAGGTGAGATGG - Intergenic
950940955 3:16891001-16891023 ACCAAGTGCTAGTGGTAAGAGGG - Intronic
951501230 3:23389790-23389812 ACCCACTTCTTGAGGTGATGTGG + Intronic
954928861 3:54262283-54262305 TCCAAGGTCGTGATGTGAGATGG + Intronic
963797808 3:149648658-149648680 GCCAAGTTCCTGAGGCCAGAAGG + Intronic
965359779 3:167724593-167724615 ACCAAATTCATGAGTTGAGATGG + Intronic
968576589 4:1369086-1369108 ATTGACTTCTTGAGGTGAGAGGG + Intronic
970614213 4:17752518-17752540 GCCATGTTCTTAAGGTGGGAAGG + Intronic
971519145 4:27527447-27527469 TCTAAGTTCTGGATGTGAGAGGG + Intergenic
975559888 4:75699106-75699128 GCAATGTTCTTGAGGTGAGAGGG - Intronic
978399364 4:108314503-108314525 ACAAAGGCCCTGAGGTGAGAGGG - Intergenic
979567760 4:122175455-122175477 ACCTAGTTCTACAGGAGAGAGGG - Intronic
980684237 4:136204453-136204475 TCCAAGTTCATGAAGTGACAAGG + Intergenic
984364145 4:178776463-178776485 AACTAGTTCATGAGGTGAAAAGG - Intergenic
986639594 5:9859084-9859106 AAAAAGTTCTTGAGCTGGGAGGG - Intergenic
987785348 5:22492180-22492202 ACTGAATTCTGGAGGTGAGAAGG - Intronic
989743899 5:44805292-44805314 ATCAAATTGATGAGGTGAGAAGG - Intergenic
990475522 5:56158528-56158550 ACAAAGTTCTTGAGGGAAGGTGG - Intronic
993336606 5:86667211-86667233 AACAAATTATTGAGGTGAGCCGG + Intergenic
993439012 5:87932243-87932265 TGCAACTTCTTGAGGTGGGAGGG + Intergenic
1004431615 6:15549987-15550009 AGGAAGTTCTTGAAGTGAGGTGG - Intronic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1005411335 6:25550557-25550579 AACAAGTTCTTGTGGTAAGGGGG + Intronic
1007169213 6:39850601-39850623 ACCAAGTTTTAGAAGTGAAAGGG - Intronic
1007218069 6:40256692-40256714 ACCAAGTCCTTGAGGTTGGAGGG + Intergenic
1007741382 6:44011875-44011897 GCCCAGTTCTTGAGTTCAGAAGG - Intergenic
1009526289 6:64750914-64750936 ACCAAGTTCTTGGCATGGGAAGG - Intronic
1013368709 6:109453210-109453232 GCCAAGTTCTTGATGGGGGAGGG + Intronic
1015968023 6:138714475-138714497 TCCAAGTTCTTGAGGCCAGCAGG - Intergenic
1016118419 6:140317089-140317111 ACAATGTGCTAGAGGTGAGAGGG - Intergenic
1018273865 6:162109090-162109112 ACCAAGTTGTTGTCGTGAAAAGG + Intronic
1024002468 7:45199755-45199777 CCCAAGTGTATGAGGTGAGAAGG - Intergenic
1025760968 7:64391081-64391103 CCCAGCTTCCTGAGGTGAGAAGG - Intergenic
1027444235 7:78254349-78254371 ACCAAGTTCTTGATATTAAATGG - Intronic
1032498465 7:132380741-132380763 AGCAAGTTCTTTGGGTGATAGGG - Intronic
1036099444 8:5761847-5761869 AGCAAGGTCTTGAGGGGAAAAGG + Intergenic
1036577973 8:10046373-10046395 ACCAACTTTTTAAGCTGAGAGGG - Intergenic
1036579200 8:10056959-10056981 ACCAAATACTTGAGGTGTTAAGG + Intronic
1037275393 8:17172886-17172908 CCCAAATTCTTGAAGTGGGATGG + Intronic
1039419001 8:37420130-37420152 ACCCTGTTCTAGAGGTGAGGAGG - Intergenic
1040617097 8:49047743-49047765 CCCAGGTTCTTGAGGCGTGATGG - Intergenic
1042730066 8:71923298-71923320 GCAAAGGTCTGGAGGTGAGAAGG + Intronic
1044320720 8:90797978-90798000 CCACAGTTCTGGAGGTGAGAAGG + Intronic
1044836215 8:96297966-96297988 ACCAGGTTCTGGGGGTGAGATGG - Intronic
1048323965 8:133424669-133424691 ACCAAGTTCTTTATGTGGGTGGG + Intergenic
1049627890 8:143634420-143634442 ACCCAGCTCTTAAGGCGAGAAGG - Intergenic
1054802005 9:69359312-69359334 ACTAAGAACTTGAGGTGAGATGG + Intronic
1054967785 9:71049530-71049552 ACCAAGTTCATGAGAGGAAAGGG + Intronic
1056528812 9:87468950-87468972 ACCAAGTTCTCCAGGTGATCAGG - Intergenic
1057347136 9:94260541-94260563 CCCAAGTTGGTGAGTTGAGAAGG + Intronic
1057846166 9:98526361-98526383 ACAAAGGTCCTGAGGTGGGAGGG - Intronic
1059302798 9:113329055-113329077 AGCAAGTTCCTGAGCAGAGAGGG - Intronic
1059459539 9:114421072-114421094 CCCAAGTTTCTGAGGTGGGAAGG - Intronic
1060282636 9:122224642-122224664 ACTAGGATCTGGAGGTGAGAGGG - Intronic
1060981792 9:127796810-127796832 ACCCAGTCCTGGGGGTGAGAGGG - Intronic
1061629265 9:131861381-131861403 AGCAAGTTCTCGCGGTGAAAGGG + Intronic
1185586141 X:1243259-1243281 GCCAAGTGCTGGAGGTGGGAAGG + Intergenic
1186210088 X:7241644-7241666 TCCAATAGCTTGAGGTGAGAAGG - Intronic
1188254221 X:27940281-27940303 ACAATGTTCTGGAGGAGAGAGGG - Intergenic
1189269221 X:39739130-39739152 TCCAAGTTCTGGAGGTGTCAGGG + Intergenic
1190809995 X:53873959-53873981 TCAAAGTACTTGAGGTGGGATGG - Intergenic
1194832595 X:98642704-98642726 ACCAACTACTAGAGGGGAGAAGG - Intergenic
1195164857 X:102209285-102209307 ATTAAGATCTTGAGGTGGGAAGG + Intergenic
1195194001 X:102477806-102477828 ATTAAGATCTTGAGGTGGGAAGG - Intergenic
1196638241 X:118029262-118029284 CCCAAGTTCCTGAGGTAACATGG - Intronic
1197688329 X:129468464-129468486 ACCAAATTCCAGAGGTGGGAAGG + Intronic
1197689117 X:129477990-129478012 GCAAAGGTCTTGAGGTGGGAAGG - Intronic
1199386392 X:147228149-147228171 ATCAAGTTCTTGAGTTGGGGAGG + Intergenic