ID: 1144182028

View in Genome Browser
Species Human (GRCh38)
Location 17:12761491-12761513
Sequence CATTGTAGCAAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144182028 Original CRISPR CATTGTAGCAAGAGGGAAGA AGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
904480614 1:30791113-30791135 CATTGCAGCCAGAGAGAAGCAGG - Intergenic
904895511 1:33814601-33814623 CATTGAAACAGGAGGGAAAAAGG - Intronic
904901178 1:33858335-33858357 TATTGCAGGAGGAGGGAAGAAGG - Intronic
904943846 1:34184594-34184616 ATTTGTTGCAAGAAGGAAGAAGG + Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905899831 1:41574166-41574188 CTCTGAAGCAAGAAGGAAGAGGG + Intronic
906005323 1:42464070-42464092 CATTGTAGCAGGAAAGCAGAAGG - Intronic
907295759 1:53452354-53452376 CATAGTATCAAGGAGGAAGAAGG - Intergenic
907868729 1:58423754-58423776 CCTTGCAGCAAAAGAGAAGATGG - Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908007298 1:59739993-59740015 CATTGTAGAAGGATGGTAGATGG - Intronic
908236781 1:62154882-62154904 CATTCTAGCAAGATGCAGGAAGG - Intronic
908582918 1:65536247-65536269 CATGGAAGCAAGAGAGAGGAGGG - Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909900865 1:81133053-81133075 CATTCTTGAAAGAGAGAAGAAGG - Intergenic
910866985 1:91797761-91797783 TTTTCTACCAAGAGGGAAGAAGG - Intronic
911686064 1:100779174-100779196 CAGTGAAGCAAGAGGAAAGCAGG - Intergenic
911721088 1:101192003-101192025 CATTGAATCATGATGGAAGAAGG + Intergenic
912493574 1:110076730-110076752 CACTGGAGGAAGAGAGAAGAGGG + Intergenic
912679178 1:111718098-111718120 CATAGTTGCAGGAGGGAAAATGG + Intronic
912942551 1:114058127-114058149 CAAGCCAGCAAGAGGGAAGATGG - Intergenic
913160446 1:116140380-116140402 TATTTTAGCAAGAGGGACGAAGG - Intergenic
915557127 1:156667083-156667105 CAATGCAGCAAGAGGAATGAGGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918482157 1:184990548-184990570 CATGGTGGAAAGAGGGAAAAAGG - Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
920188321 1:204176300-204176322 CACTGCAGCAGGAGGAAAGAAGG + Intergenic
920188351 1:204176491-204176513 CATTATGGAAAGTGGGAAGAAGG + Intergenic
921397896 1:214688435-214688457 TATGGTAGCATGAGGAAAGAGGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923149780 1:231222452-231222474 CATTTTTACAAGAGGGAATAGGG + Intergenic
923225354 1:231934104-231934126 CAATGAAGAAAGTGGGAAGAGGG + Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
924942609 1:248822476-248822498 CAGTTTAGCAAGAGAGACGAGGG + Intronic
1063297287 10:4819648-4819670 AAATGAAGAAAGAGGGAAGAAGG + Intronic
1065373741 10:25016225-25016247 CGCTGCAGAAAGAGGGAAGAGGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1065806505 10:29398115-29398137 AATTGCAACAAGAGGGATGAGGG + Intergenic
1066263168 10:33748687-33748709 CATTCTAGCAAAGGGGAAGAGGG + Intergenic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1068461177 10:57331015-57331037 AATTGTGGCAAGTGGAAAGATGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1069738092 10:70670605-70670627 CATTGTAGCCCCAGGGAAGGGGG + Intergenic
1069834243 10:71298711-71298733 CATGGGAGCAGGAGGGAACACGG + Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1070767271 10:79063992-79064014 CATGGTAGAAAGTGAGAAGACGG + Intergenic
1071345869 10:84692025-84692047 CATTGTAACAAGAGAAAAGGAGG + Intergenic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074796477 10:116950774-116950796 CATTGTAACGAATGGGAAGAAGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074998858 10:118780301-118780323 CCTTGTAGCCATAAGGAAGAAGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078877831 11:15415779-15415801 AATTGTGGCAAGAGGGCAGGGGG - Intergenic
1079248745 11:18772198-18772220 CTGTGTAGCAAGAGGCAAGCAGG - Intronic
1079539019 11:21549826-21549848 AATTATTGCAATAGGGAAGAGGG + Intronic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1080185779 11:29483706-29483728 CATAATAACAAAAGGGAAGAAGG - Intergenic
1080381324 11:31775040-31775062 CATTTCAGCAAGTGGGAAGAGGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1082203835 11:49406279-49406301 AATTATAGCAAAAGGGAAGGTGG + Intergenic
1082782952 11:57301310-57301332 CATTGCAGGCAGAGGGAACAGGG - Intronic
1082784462 11:57309274-57309296 CCTTCTAGCAAGATGGAAGGTGG - Exonic
1083989881 11:66240439-66240461 CCTTGTAGCAACAGCGAGGATGG + Intronic
1084043251 11:66554869-66554891 CATTCCAGCCAGAGGGAAGCTGG + Intronic
1085122281 11:73974845-73974867 GAATGTAGAAAGAGGGAAGGTGG + Exonic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1086402734 11:86473800-86473822 GATTGGAGAAAGAGGGAATACGG + Intronic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1090919368 11:131194535-131194557 CATTTTAACAAGAGAGAAGCGGG - Intergenic
1092025059 12:5233091-5233113 CCTCCTTGCAAGAGGGAAGAGGG - Intergenic
1092092397 12:5813634-5813656 AATTGTAGTGAAAGGGAAGATGG - Intronic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094166577 12:27449723-27449745 CAATGTACCAAGAGGGGAGTGGG - Intergenic
1094414690 12:30204120-30204142 TCTTGTAGCAAGAGAGAAAAAGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096069229 12:48765684-48765706 AATTGTGGCAAGAGTGCAGAGGG + Intergenic
1097431497 12:59513919-59513941 CATCTTATCAAGAAGGAAGATGG + Intergenic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1099872104 12:88362269-88362291 CATTGGAGCAAGAGGGCTTATGG + Intergenic
1100476654 12:94941353-94941375 TATTTTACCAAGAGGGAAGCTGG + Intronic
1100574266 12:95874805-95874827 CATTGTATCAAAACGGGAGAGGG + Intronic
1101157723 12:101943651-101943673 CATAGTAGCAAGAGGGCTGGGGG + Intronic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1104169444 12:126265887-126265909 AATTGTAGCAAGGGGGACAAGGG - Intergenic
1104230139 12:126876736-126876758 CTCTGTAGCAAGAGGGAAGCAGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106967623 13:35090260-35090282 CATTGTAGGAGGCGGGGAGAGGG + Intronic
1110534477 13:76635296-76635318 GATAGCAGTAAGAGGGAAGATGG + Intergenic
1111011456 13:82320551-82320573 CATTATTGCAATGGGGAAGATGG - Intergenic
1111098992 13:83555871-83555893 CATACCAGCAAGAGGGAGGATGG + Intergenic
1113184006 13:107665461-107665483 CATTGTAGCAAAAGCTAATATGG - Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116623259 14:47233585-47233607 CATTAAAGCAAGATGGCAGAGGG + Intronic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1117125321 14:52617057-52617079 CATAGCAGCCAGAGGAAAGAAGG - Intronic
1118250287 14:64153495-64153517 ATTTGTACCAAGAGGGAATAGGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119151934 14:72368602-72368624 AATTGAAGCAAGAGGGAGGCAGG - Intronic
1119215789 14:72868190-72868212 CATTGGAGAAAGAGGTATGAAGG + Intronic
1120488715 14:85148990-85149012 ATTTTTAGAAAGAGGGAAGAAGG + Intergenic
1121152809 14:91652707-91652729 AAATGCAGCAAGAGGCAAGAGGG + Intronic
1121163847 14:91772604-91772626 GATTGGAGAGAGAGGGAAGAAGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1123458557 15:20447081-20447103 CAGTTTAGCAAGTGGGAAAAGGG - Intergenic
1123659506 15:22553328-22553350 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1124176144 15:27425965-27425987 CATTGTAGCCAGATGGGAGAGGG - Intronic
1124264847 15:28223251-28223273 CAGTTTAGCAAGTGGGAAAAGGG - Intronic
1124313367 15:28647823-28647845 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1127045208 15:55017958-55017980 GTTTGTAGCAAGGGAGAAGATGG + Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1131023756 15:89122199-89122221 CATGGTAGGAAGATGGAAGAAGG - Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1133854572 16:9537450-9537472 CAAAGTAGCAAGTGAGAAGAGGG + Intergenic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1135356812 16:21775776-21775798 GATTGTAGCAAGAGGAAGTAGGG + Intergenic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1137750617 16:50858710-50858732 CATTGCTGCAAGTGGGAGGAGGG - Intergenic
1138448038 16:57077085-57077107 AATTGTAGCAAGAGGGATTTAGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1141022292 16:80508674-80508696 CATTGTAGCAAGGAGAAGGAGGG - Intergenic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1141837060 16:86548198-86548220 TATTGTAAGAAAAGGGAAGACGG - Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144247330 17:13380085-13380107 GATTGTAGCAAGAGGTCAGAGGG + Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144422632 17:15112011-15112033 CACTGTAGCAGGAGGGGAGTGGG + Intergenic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1146039148 17:29434412-29434434 CAATCTAGAAAGAGGGAAGCAGG + Intronic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1147657607 17:42099454-42099476 GAATGTAGCAGGAGGGAAGGAGG + Intergenic
1147893123 17:43731537-43731559 TATTTTAGCAAGGAGGAAGAAGG - Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150594871 17:66595131-66595153 AATTGGAGGAACAGGGAAGAGGG - Intronic
1151058100 17:71057507-71057529 CATTTTAGCAATAAGGAAAACGG + Intergenic
1152517258 17:80832875-80832897 ATTTTTAGCAAGAGGAAAGAGGG + Intronic
1155168783 18:23251653-23251675 CAATTTAGAAAGAGGGAAGGAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155857945 18:30858262-30858284 CATTGTACAAAGAGAGAAAAAGG - Intergenic
1157044873 18:44089425-44089447 CATTCTAGCTACATGGAAGATGG - Intergenic
1158696346 18:59707464-59707486 CATTGCAGGAAGAAGCAAGAAGG - Intergenic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1161805804 19:6442247-6442269 CATTGCAGCAGGAGGGAAGGAGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163627355 19:18397754-18397776 GGTTCTAGCAAGAGGGAAGCGGG - Intergenic
1164140670 19:22459197-22459219 CATTTTAGCAAGAGGAGAAAGGG - Intronic
1167505251 19:49867678-49867700 CGTTGCAGCAAGAGAGATGAAGG - Intronic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
925490679 2:4389722-4389744 CATGGTAGCCAAAGTGAAGAGGG + Intergenic
925901807 2:8514181-8514203 CATGGTAGCAAGAGAGACCAGGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926579985 2:14624328-14624350 TATTAGAGCAAGAGGGATGAGGG + Intergenic
927770093 2:25853081-25853103 CATGGTGGAAAGGGGGAAGATGG - Intronic
928739052 2:34328275-34328297 AATTGTAACATGAGAGAAGATGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
930337264 2:50064857-50064879 CTTTGTAACATGAGGGCAGAGGG + Intronic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
933990986 2:87633621-87633643 CATTGCAGGAGGAGGTAAGAAGG - Intergenic
936302853 2:111317202-111317224 CATTGCAGGAGGAGGTAAGAAGG + Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
936787260 2:116108403-116108425 GATTGAAGCAAGATGGAAGCAGG + Intergenic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
943430589 2:187796200-187796222 AAGTGTACCAAGAGGGATGATGG + Intergenic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
944636382 2:201679543-201679565 AATGGTACCACGAGGGAAGATGG - Intronic
945146886 2:206747792-206747814 CACTGAAACAATAGGGAAGATGG + Intronic
945507577 2:210660127-210660149 CAATGAAGCAAGAGGACAGAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946672492 2:222121215-222121237 AATAGAAGAAAGAGGGAAGAAGG + Intergenic
947360766 2:229343202-229343224 GATGGTAGGAAGTGGGAAGACGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948705098 2:239785996-239786018 CATAGTAGCAAAAGGACAGAAGG + Intronic
1169816909 20:9666600-9666622 CATTGTAGCCAGAAGTAAGAAGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173135741 20:40437335-40437357 CATTGTACCAAAAGTGAAGAAGG + Intergenic
1173495661 20:43515412-43515434 CATGGTAGGAAGAGGGCAGTGGG + Exonic
1174435758 20:50505631-50505653 CCTTGTAGGAACAGGGCAGAGGG + Intergenic
1174623389 20:51894484-51894506 CATTCTAGCAAGAGCGTGGAGGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1176045087 20:63088388-63088410 CATTGCAGCAAGAGGAACAATGG - Intergenic
1177603857 21:23353979-23354001 CATTGTAAGAAGAGCCAAGAGGG - Intergenic
1177615443 21:23511717-23511739 GATTTTAGCAAGGGTGAAGAAGG - Intergenic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1178220556 21:30653125-30653147 CATTGGAGAAAGAAGGGAGAAGG + Intergenic
1182642607 22:31780543-31780565 CATGGTGGCAAGAGAGAAGGTGG - Intronic
1185104028 22:48857346-48857368 CACTGTAGGAAGAGGCAGGAAGG - Intergenic
949562949 3:5219577-5219599 CCTTGCAGAAAGAAGGAAGAGGG - Exonic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
954831301 3:53423521-53423543 CATTGTACAGAGAGGGAAAAAGG - Intergenic
955096117 3:55800025-55800047 TATTGAAACAAGATGGAAGATGG + Intronic
955109714 3:55936373-55936395 CATTCTAGGAGGAGGGATGATGG + Intronic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
956367195 3:68517094-68517116 CAATGTAGCAAAAGGATAGAAGG - Intronic
956581161 3:70815324-70815346 CATAGGAACAAGATGGAAGAAGG + Intergenic
957179434 3:76857940-76857962 CATTTTAGGAAGAGGGAATCGGG - Intronic
957286073 3:78219096-78219118 CCTTGTAAAAAGAGGGAAAAGGG - Intergenic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
957532311 3:81456009-81456031 GAAGGTAGCAAGTGGGAAGAGGG + Intergenic
959273900 3:104252125-104252147 CATTGTAGAAAGAGGCAAAATGG - Intergenic
959667892 3:108941978-108942000 AATTAGAGCAGGAGGGAAGAGGG - Intronic
959922801 3:111887405-111887427 CATTGTGGTAAAAGGGATGACGG + Intronic
960031204 3:113056623-113056645 TACTGGAGCAAGAGGGTAGATGG + Intergenic
960892045 3:122459434-122459456 CTTTGTAGGAAGAGGGAGGTAGG - Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
963901560 3:150737928-150737950 CATTGGAGCAGGCAGGAAGAAGG + Intergenic
964387225 3:156160886-156160908 CATTGTGGCATGAAGGAAGGAGG + Intronic
966627509 3:182034255-182034277 TATTGTAGGAAGAGGGGACATGG - Intergenic
966796381 3:183718505-183718527 GATTGAAGCAAGAAGGATGATGG + Exonic
967323250 3:188214609-188214631 CTTTGAAGCAAGTGGGAGGAGGG + Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
970041241 4:11799326-11799348 CATTGAAACAACAGGCAAGAAGG + Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971189609 4:24414817-24414839 CATTCCAGCAAGAAGGAAGAAGG - Intergenic
971833956 4:31737434-31737456 GAATGTAGCATGAGGGAGGAGGG - Intergenic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
973742245 4:53929365-53929387 CATTTTAGAAAGAAGAAAGAAGG - Intronic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
975489752 4:74975781-74975803 CATTGAAGCAATAGGGAGGAGGG + Intronic
975550369 4:75606867-75606889 CATTGTTGGAATGGGGAAGATGG - Intronic
976541243 4:86279647-86279669 CATTGCAGCAAGAGAGCAAAGGG - Intronic
978181879 4:105807989-105808011 CATAGGATCAAGAGAGAAGAAGG - Intronic
978349072 4:107802378-107802400 AATTTGAGAAAGAGGGAAGAGGG - Intergenic
979434251 4:120670493-120670515 CCTTGGAGGAAGTGGGAAGAAGG + Intergenic
982362014 4:154529034-154529056 CATAGTAGCTACAGGGAAGTAGG - Intergenic
982484888 4:155954410-155954432 GATTGTGGCAAGAAGGAAAAAGG - Intergenic
983520685 4:168705489-168705511 AATTGCAGCAAGAGAGCAGAAGG - Intronic
984166185 4:176305386-176305408 CATTATAGCCAGAGAGAACAAGG - Intergenic
984713294 4:182903732-182903754 CATTGTTGCAGGAGCGGAGACGG - Intronic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
985286619 4:188342856-188342878 CATAGTAGTTACAGGGAAGATGG + Intergenic
987215327 5:15731102-15731124 CTTGTTAGCAAGAGGGAAAATGG + Intronic
987481294 5:18461767-18461789 CAAAGTAGCAAGAGAAAAGAGGG - Intergenic
988934299 5:36066953-36066975 CAATGGAGCACGAGGGAGGAGGG - Intronic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989604430 5:43230336-43230358 CATTCTAGCTAGCAGGAAGATGG + Intronic
990621298 5:57562212-57562234 CATTGTAGTAAGAGGCAAGTTGG - Intergenic
990780122 5:59351304-59351326 CATTGTAGGAAGAGGTAGCATGG - Intronic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995957961 5:117802575-117802597 CTTTGTAGCAACATGGATGAAGG + Intergenic
997509661 5:134445306-134445328 CATTGCAGCTAGTGGGAAGAAGG + Intergenic
998536427 5:142935740-142935762 CATTGTTGTATGAGGGAAGGAGG + Intronic
998953895 5:147418567-147418589 CATTGAAGCCAATGGGAAGATGG - Exonic
998958503 5:147461165-147461187 CATGGTAACAAAAGGGAAAATGG - Intronic
999245832 5:150154215-150154237 CATTCCAGAAAGGGGGAAGAGGG + Intronic
999636599 5:153629393-153629415 CATTGAAGAAAGTGAGAAGAAGG + Intronic
1000002470 5:157152141-157152163 AATTATAGGAAAAGGGAAGAAGG - Intronic
1000257992 5:159559145-159559167 CATTGAAGCCACTGGGAAGAAGG + Intergenic
1000306908 5:160003021-160003043 TATAGTATCAAGAGGGAAGGTGG + Intergenic
1000903927 5:166939915-166939937 TATTTTATCAAGAGGGAAAAAGG - Intergenic
1005143482 6:22661404-22661426 CATTGTGGCAGGAAGGAAAAGGG + Intergenic
1006709095 6:36049861-36049883 AGTTATAGCAAGAGGGAAGGTGG + Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1010407562 6:75522282-75522304 TATTATAGGAAAAGGGAAGATGG - Intergenic
1011757098 6:90510845-90510867 CATTGCCGCCAAAGGGAAGAGGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1013348402 6:109284365-109284387 CATTGCAGCAGGAGGGCAGGTGG - Intergenic
1013409988 6:109875618-109875640 CATTGGAGCTAGAGGGACCATGG + Intergenic
1014370254 6:120597761-120597783 CATTTCAGCAAGTGGGAAAAGGG + Intergenic
1014841013 6:126220087-126220109 AATTGTTGCAGAAGGGAAGACGG + Intergenic
1014898731 6:126936539-126936561 GATTGGAGCAATATGGAAGAAGG + Intergenic
1015293269 6:131561872-131561894 GGTTGTAGCAAGATGGAATAGGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1017990271 6:159481607-159481629 CATTTCAGAAAGAGGAAAGATGG - Intergenic
1019791159 7:3014766-3014788 CATTGCCGCAAGCGGGAAAATGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1023189302 7:37562155-37562177 CATTGTAGAAAGAAAGAAAATGG + Intergenic
1023201146 7:37698312-37698334 CATGGTGGTAGGAGGGAAGAAGG - Intronic
1030058190 7:105601562-105601584 CATGGGAGAAACAGGGAAGAAGG + Intergenic
1030418977 7:109283455-109283477 CTTCATAGCAAGAGGGAAGAAGG - Intergenic
1032008408 7:128323590-128323612 CACTGCAGAAAGAGGGAAAAAGG + Exonic
1032110213 7:129069460-129069482 CATTGGAGGAAGAGGGAAATTGG - Intergenic
1032650919 7:133877581-133877603 CACTGTAGCTAGTGGGAACATGG + Intronic
1032834328 7:135659422-135659444 CATGGTAGCAGGAGAGAAAAAGG - Intergenic
1032986161 7:137339720-137339742 CATCATAGCAAGAGGGAATTGGG + Intronic
1033928047 7:146488320-146488342 CATTAAAGCAAGAGGAAGGAAGG - Intronic
1035907520 8:3529859-3529881 AATTATAGCAAGAGAGAAGCAGG + Intronic
1036761450 8:11512032-11512054 CAATGTATCAAGTGGTAAGATGG + Intronic
1038113635 8:24528233-24528255 CATGGTAGAAAGAGGGGAGGGGG + Intergenic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038869911 8:31482425-31482447 AATTGCAGCAAGAGGGAAGGTGG - Intergenic
1039453505 8:37694098-37694120 CATTGCAGCAAGAGGGGTGCGGG - Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1042666643 8:71214162-71214184 CATTCTAGCAGGTGGCAAGAGGG - Intronic
1042944537 8:74142082-74142104 CATTGGAGCGAGAGGCAAGCGGG + Intergenic
1044396847 8:91722539-91722561 ATTTTCAGCAAGAGGGAAGAGGG + Intergenic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1047783529 8:128131349-128131371 CATTGGATCAAAAGGGAGGATGG - Intergenic
1049218570 8:141418621-141418643 CTTGGTAGCAGGAGGGAAGGAGG + Intronic
1050350253 9:4734377-4734399 CATGGGAGCAGGAGGGCAGATGG - Intronic
1050631359 9:7561948-7561970 CATTTTTCCAAGAGGAAAGATGG + Intergenic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1051762153 9:20479408-20479430 TCTTATAGCAAGAGGGAAAATGG + Intronic
1052462097 9:28777930-28777952 TAATGTAGCAAGAAGGCAGAAGG - Intergenic
1056317625 9:85406500-85406522 CAATGCAGGAAGATGGAAGAGGG - Intergenic
1056452688 9:86731866-86731888 CATTGCAGAAAGAGGAAAAATGG + Intergenic
1057985901 9:99713450-99713472 CATTGTAGCAACATGGATGCAGG - Intergenic
1058145483 9:101406331-101406353 TATTGAAGAAAGAGGAAAGACGG + Intronic
1059099621 9:111457488-111457510 CATTGTAACAGGAGGGAAACAGG + Intronic
1059204951 9:112455872-112455894 CATTCTACTAAGAGGGAAGGAGG - Intronic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1185872201 X:3673613-3673635 CATGGTAGCAAGATGGCGGAGGG + Intronic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1186226993 X:7410017-7410039 ATTTGTTGCAAGAGGGAACACGG + Intergenic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1187985825 X:24809446-24809468 CATTGAAGAAAGAGAGTAGATGG - Intronic
1188435281 X:30151700-30151722 CATTGTAGCAAGAAAGCAGCTGG + Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1193651778 X:84144381-84144403 CATTTTACCAAGAGGATAGATGG + Intronic
1194287493 X:92028391-92028413 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1194968810 X:100320082-100320104 CGTTGTGGCAAGAGGAATGAGGG - Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195308163 X:103606250-103606272 AAATGTAGCAAGAGTGGAGATGG + Intergenic
1196998011 X:121405538-121405560 CATTCAAACAAGAGGAAAGATGG + Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198206832 X:134473690-134473712 CATTGAAGGGAGATGGAAGAAGG + Intronic
1198329270 X:135606624-135606646 CATTATGCCAAGAGGTAAGAAGG + Intergenic
1198329307 X:135607027-135607049 CATAGTCTCATGAGGGAAGAAGG + Intergenic
1199290114 X:146095712-146095734 CTTTGTAGCAACAGGGATGGAGG + Intergenic
1199508630 X:148594719-148594741 CCTTGAAGCAGGAGTGAAGAGGG + Intronic
1199743806 X:150759300-150759322 TATTTTGGCAACAGGGAAGATGG + Intronic
1200605032 Y:5252958-5252980 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1202092951 Y:21213167-21213189 CGTTGTAGAAAGAGGGAATCAGG - Intergenic