ID: 1144185521

View in Genome Browser
Species Human (GRCh38)
Location 17:12791653-12791675
Sequence ATTTTTCAGCCTCATCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144185518_1144185521 -6 Left 1144185518 17:12791636-12791658 CCATGGCATCATATCTTATTTTT 0: 1
1: 0
2: 7
3: 120
4: 2057
Right 1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG 0: 1
1: 0
2: 2
3: 31
4: 318
1144185516_1144185521 23 Left 1144185516 17:12791607-12791629 CCTGTTTTTAAATGGGGGAGATT 0: 1
1: 0
2: 4
3: 20
4: 320
Right 1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG 0: 1
1: 0
2: 2
3: 31
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144185521 Original CRISPR ATTTTTCAGCCTCATCCATG GGG Intronic
900891788 1:5454798-5454820 ATTTTTCCGTTTCATCCCTGAGG + Intergenic
901553560 1:10014122-10014144 AACTTTCAGCCTCATCCCTGAGG + Intronic
901584972 1:10282388-10282410 ATTTTTCCACAGCATCCATGGGG + Exonic
902824133 1:18961178-18961200 GTCTTTGAGGCTCATCCATGTGG + Intergenic
903005306 1:20294333-20294355 GTTTTGCAGGCTCATCCTTGGGG - Intronic
905182455 1:36175657-36175679 ATTTTTAAGCCTCAGTCAGGTGG - Intronic
905587242 1:39130151-39130173 ATTTTTCCCCCCCATTCATGGGG + Intronic
907640139 1:56180646-56180668 ATTTTCCAGCCTTATTGATGTGG - Intergenic
908053240 1:60255715-60255737 ATTTTTCCTCCTCATCCCAGAGG - Intergenic
908423210 1:63979806-63979828 CGTTTTCAGATTCATCCATGTGG - Intronic
909008065 1:70300479-70300501 ATTCTTCAGCCTCAGCCTTCAGG - Intronic
909181866 1:72434435-72434457 AGTTTGAAACCTCATCCATGGGG - Intergenic
909543680 1:76819323-76819345 ATTTCTCAGACTGATCCATATGG + Intergenic
911035299 1:93537680-93537702 ATCATACAGACTCATCCATGGGG - Intronic
911067704 1:93806292-93806314 ATATTTAAGCCTCAACCATCTGG - Intronic
911273100 1:95827477-95827499 ATTTTTCAGCCCCTGCCATATGG + Intergenic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
912856450 1:113172706-113172728 ATTTTTCAGCCTCTTGTATCTGG - Intergenic
912904846 1:113693465-113693487 AATTTTGAGGCTCATTCATGTGG + Intergenic
913083363 1:115410744-115410766 ATAATTCAGCCTCATCAATTGGG + Intergenic
913302988 1:117392932-117392954 CTTTTTTAGCCTCTTTCATGTGG + Intronic
913941486 1:125112290-125112312 ATTATTCAGCCTTAAACATGAGG - Intergenic
914446543 1:147755512-147755534 ATTTCACAGACTCATCCTTGGGG + Intergenic
916380958 1:164210043-164210065 ATTTTTCACCTTCATCCTTCAGG - Intergenic
918678083 1:187315225-187315247 GTCTTTCAGTCTCATCCATTTGG + Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919447750 1:197730372-197730394 ATTATTCAGCTCCATCCATGTGG + Intronic
920681098 1:208073375-208073397 AGTTTCCAGCCTCTTCCAGGTGG + Intronic
920846832 1:209600617-209600639 TTTTGTCTGCCTCATCCTTGTGG - Intronic
920989306 1:210921590-210921612 ATTTTGCAGCTTCTTCCATCTGG + Intronic
922429421 1:225534208-225534230 ATTTTTCTGCCTCCTCCTGGGGG - Intronic
923525884 1:234772437-234772459 TTTTTCCACCCTCAGCCATGCGG - Intergenic
923794355 1:237139228-237139250 GTTTTCAAGACTCATCCATGTGG - Intronic
923810103 1:237305321-237305343 ATTTTTGAGATTAATCCATGTGG - Intronic
923948401 1:238918691-238918713 ATTTTTGAGATTCATCCATGTGG - Intergenic
924248482 1:242107964-242107986 GTTTTTCAGCCTCTCCGATGAGG - Intronic
924826369 1:247543529-247543551 AGTGTTCCGCCTTATCCATGGGG - Intronic
1063598618 10:7460324-7460346 GGTTTCCAGCTTCATCCATGTGG + Intergenic
1064974596 10:21100342-21100364 ATTTTTCAGCTTCTTCACTGTGG - Intronic
1066370440 10:34814908-34814930 AGTTTTCAGCCTCATCCAGCAGG - Exonic
1066782200 10:38963835-38963857 ATTATTCAGCCTTAAACATGAGG - Intergenic
1066951206 10:42119257-42119279 ATTATTCAGCCTTAAACATGAGG + Intergenic
1067443229 10:46324465-46324487 AATCTTCAACCTCATCCATTTGG + Intronic
1068027994 10:51672598-51672620 ATTTTTCTGACTCCTTCATGTGG + Intronic
1068054024 10:51988264-51988286 ATTTTTGAGATTTATCCATGTGG + Intronic
1070716827 10:78728623-78728645 ATTTCTCAGCCTCATGTAGGTGG - Intergenic
1071479731 10:86056135-86056157 ATTTCTCAGCCACACCCTTGGGG + Intronic
1072200829 10:93157283-93157305 ATTTTTCAAATTGATCCATGTGG + Intergenic
1072491996 10:95916818-95916840 ATTCTTGAGCATGATCCATGTGG + Intronic
1072605559 10:96979147-96979169 ATTTTTCTGTCTCAGTCATGAGG - Intronic
1074092554 10:110275262-110275284 ATTTGGCAGCCTCATACAGGAGG + Intronic
1075016066 10:118910729-118910751 ATTTTCCAGCCACCTACATGAGG + Intergenic
1075170197 10:120106245-120106267 GTTTTCAAGCCTCATCCATGTGG + Intergenic
1075825194 10:125350355-125350377 AGTTTTCAGCTTCATGCCTGGGG - Intergenic
1075861737 10:125683128-125683150 ACTTCTCAGCCTCTTCCAGGAGG + Exonic
1076275404 10:129194491-129194513 ATTTTTCTTCTTCTTCCATGAGG + Intergenic
1078916306 11:15781890-15781912 AGTCTTAAGCCTCATCCCTGGGG - Intergenic
1080075373 11:28141332-28141354 ATTTTTCAGACTCGTGCATTCGG - Intronic
1080399364 11:31919963-31919985 AGTTTTCAGCCTCTTCCCTGGGG + Intronic
1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG + Intergenic
1080972013 11:37289012-37289034 ATTTCTCAAAGTCATCCATGAGG + Intergenic
1081844395 11:46228946-46228968 ATTTTCAGGGCTCATCCATGTGG - Intergenic
1081877191 11:46416858-46416880 AGTTTCCAGCCTCAGCCAGGTGG - Intronic
1082693498 11:56332297-56332319 ATTTGTCAGGCACAGCCATGAGG + Intergenic
1084498147 11:69517363-69517385 ATTTTTCCCTCTCTTCCATGAGG + Intergenic
1084552596 11:69855126-69855148 ATTTTTAAGTTTCATCCATATGG - Intergenic
1085949861 11:81317491-81317513 ATTTTTAAGGTTCATCCATGTGG - Intergenic
1086964540 11:93014226-93014248 ATTTTTCAGGGCCATCCATGTGG + Intergenic
1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG + Intronic
1088184813 11:107154711-107154733 ATCTTTCAGTCACATTCATGTGG + Intergenic
1089266425 11:117266004-117266026 ATTTTTGAGATTCATCCATGAGG + Intronic
1089413978 11:118271618-118271640 GATTTTCAGCCTCATCTCTGAGG - Intergenic
1089664987 11:120012735-120012757 ATTTTCCTGCCTCATCCAGTAGG + Intergenic
1093221794 12:16430248-16430270 ATTCCTCAAACTCATCCATGAGG + Intronic
1093433449 12:19108829-19108851 GTTTTTAAGGTTCATCCATGTGG + Intergenic
1094106843 12:26821663-26821685 ATTCTTAAACTTCATCCATGTGG + Intronic
1094463929 12:30730184-30730206 ATTTTTCAGCCTTTTGCATAGGG - Intronic
1094644897 12:32313214-32313236 ATATTTCTTCCACATCCATGAGG - Intronic
1097480025 12:60112411-60112433 GTTTTTGAGCCTCATCCATCAGG - Intergenic
1097538004 12:60898231-60898253 GTTCTTCAGTTTCATCCATGTGG + Intergenic
1097538009 12:60898317-60898339 GTTCTTCAGTTTCATCCATGTGG + Intergenic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1098053818 12:66482432-66482454 GTTTTCCAGCATTATCCATGTGG + Intronic
1098388794 12:69947276-69947298 ATTTATGAGCCTCCTCCCTGAGG + Intronic
1098851800 12:75604691-75604713 ATTTGTCTGCCTCATACAAGAGG - Intergenic
1099304235 12:80935731-80935753 TTTTTTCAGACTCATCCACAGGG + Intronic
1101230498 12:102736483-102736505 AATTTACAGCCTCACCAATGGGG - Intergenic
1101264919 12:103074190-103074212 ATTTTTCATCCTCAGCCCTCTGG - Intergenic
1102901717 12:116643904-116643926 ATTTTTCAGCCTACTGCAAGAGG - Intergenic
1103138509 12:118528236-118528258 TAATTTCAGCCTCATCTATGGGG - Intergenic
1103267948 12:119646758-119646780 ATTTTTCTGGATCATCCAGGTGG - Intergenic
1103744153 12:123110862-123110884 ATTTTCCAGCCTCCTCTCTGCGG - Intronic
1106890431 13:34239642-34239664 ATTTTTCATACTCAGCCATCTGG + Intergenic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1108366806 13:49724075-49724097 ATTCTTCAGGTTCATCCATGTGG + Intronic
1108481283 13:50874714-50874736 AGTTTTGAGATTCATCCATGTGG + Intergenic
1109511251 13:63377493-63377515 ATTTTTCAGGCTCAAACATCTGG + Intergenic
1110937734 13:81313640-81313662 ATTTTTAGCCCTCATCCATTCGG + Intergenic
1111660051 13:91198373-91198395 GTCCTTCAGCCTCATACATGTGG - Intergenic
1113246191 13:108398345-108398367 TTCTATCAGCCTCCTCCATGAGG + Intergenic
1114052411 14:18931733-18931755 ATTTTCCAGGTTCATCCATATGG + Intergenic
1114054450 14:18954736-18954758 ATTTTCCAGGTTCATCCATATGG + Intergenic
1114108104 14:19447196-19447218 ATTTTCCAGGTTCATCCATATGG - Intergenic
1114110147 14:19470192-19470214 ATTTTCCAGGTTCATCCATATGG - Intergenic
1114585650 14:23810760-23810782 GGTTTCCAGCTTCATCCATGAGG + Intergenic
1115202897 14:30873330-30873352 GTTTTTGAGGTTCATCCATGAGG - Intergenic
1115736782 14:36340764-36340786 ATTTTACAGCTGCATCTATGAGG + Intergenic
1116345134 14:43784140-43784162 CTTTTTTAGGCTCATCCCTGTGG + Intergenic
1116979248 14:51150400-51150422 AATCTTCATCCTCATCTATGAGG - Intergenic
1119030348 14:71187530-71187552 GTTTTTCATCCTCATGCTTGTGG - Intergenic
1119408763 14:74415053-74415075 ATTTTTCACCCCCAGCCCTGAGG - Intronic
1119484562 14:74979348-74979370 AGCTTTCAGCCTCTTCCCTGGGG + Intergenic
1119536854 14:75409721-75409743 TTTTCTCAGCCTCCTCCATTGGG + Intergenic
1121021425 14:90582488-90582510 ATTTTCCTGCCACATCCATCAGG + Intronic
1121243724 14:92448016-92448038 GTTTTCCAGGTTCATCCATGTGG - Intronic
1121582878 14:95044304-95044326 ATTCTTCAGCCACAGCCCTGTGG + Intergenic
1121882969 14:97516742-97516764 GTTTTTCAGCCTCCTGGATGTGG - Intergenic
1125105398 15:35964846-35964868 TTTTTTTAGCCTTATCCATTAGG + Intergenic
1126494296 15:49273365-49273387 ACTTTTCAGCCTGAACCATCAGG + Intronic
1127141488 15:55982455-55982477 TTTTTTGAGAGTCATCCATGGGG - Intronic
1128337847 15:66798885-66798907 ATTTTGCAGTCTCATCCATCTGG - Intergenic
1131748116 15:95472099-95472121 TTTTATCAGCCTCAGGCATGAGG - Intergenic
1132220718 15:100103101-100103123 ATGTTCCTGCCTCTTCCATGCGG - Intronic
1132229633 15:100171765-100171787 ATTTACCAGCCCCTTCCATGTGG - Intronic
1133112264 16:3555286-3555308 GTTTTTAAGCTTCATCCGTGTGG - Intronic
1133464133 16:6013813-6013835 GGTTTCCAGCTTCATCCATGCGG - Intergenic
1133602403 16:7352213-7352235 ATTTTTCAGCCTTTCCCAAGAGG + Intronic
1134492609 16:14706591-14706613 ATTTTTCAGCTGCATCCCTTCGG - Intergenic
1134497990 16:14745713-14745735 ATTTTTCAGCTGCATCCCTTCGG - Intronic
1135151298 16:20008610-20008632 ATTTTTGGGGCTTATCCATGTGG + Intergenic
1135497982 16:22969262-22969284 ATTTCCCAGCCTCATCCACTTGG - Intergenic
1136697069 16:32091831-32091853 ATTATTCAGCCTTAAACATGAGG + Intergenic
1136797568 16:33035122-33035144 ATTATTCAGCCTTAAACATGAGG + Intergenic
1136960457 16:34841211-34841233 ATTATTCAGCCTTAAACATGAGG - Intergenic
1137084967 16:36108529-36108551 ATTATTCAGCCTTAAACATGAGG + Intergenic
1139423401 16:66863457-66863479 ATTTCTCAACCTTATCAATGTGG - Intronic
1139492535 16:67294063-67294085 ACTGCTCAGCCTCATCCATCTGG + Exonic
1140770268 16:78197333-78197355 AATTTACAGCATCATCCAGGAGG - Intronic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1143330024 17:6127166-6127188 ATTTTGAAGCATCATCCAAGAGG + Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144533635 17:16064965-16064987 ATTTTAGTGCCTCATCCAGGGGG - Exonic
1144591690 17:16529454-16529476 CTTTTTCAGATTTATCCATGTGG - Intergenic
1144928295 17:18833153-18833175 GTTTTTCCCCCTTATCCATGGGG + Intergenic
1145326638 17:21835976-21835998 ATTATTCAGCCTTAAACATGAGG - Intergenic
1145689609 17:26725146-26725168 ATTATTCAGCCTTAAACATGAGG - Intergenic
1146363600 17:32200046-32200068 ATTCTCCTGCCTCAGCCATGAGG + Intronic
1146621821 17:34404669-34404691 ACTGTTCAGCTCCATCCATGGGG + Intergenic
1148824313 17:50380947-50380969 GCTTTTCATCCTCATCCCTGAGG - Exonic
1149350004 17:55776790-55776812 ATTTTTCCTCATCATCCATGAGG + Exonic
1203190828 17_KI270729v1_random:186573-186595 ATTATTCAGCCTTAAACATGAGG - Intergenic
1153664516 18:7357005-7357027 ATTTTACAGATTTATCCATGTGG + Intergenic
1154056423 18:11016758-11016780 AGTTTTCATCCCCATACATGTGG + Intronic
1154516383 18:15171208-15171230 ATTATTCAGCCTTAAACATGAGG + Intergenic
1155500123 18:26479460-26479482 GTTTTTCAGCCCCTTCCATCGGG - Intronic
1157554581 18:48604917-48604939 ATTTTCAAGGTTCATCCATGTGG + Intronic
1158636660 18:59164827-59164849 ATTTCTCAAACTCATCTATGAGG + Intergenic
1160303237 18:77705476-77705498 AAGTTTCACCCTCACCCATGTGG + Intergenic
1161638900 19:5407212-5407234 ATTATTCATCCTCATCTTTGAGG - Intergenic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1166245934 19:41525639-41525661 ATTTTTGAGAATGATCCATGTGG - Intergenic
1166262179 19:41648005-41648027 ATTGTTCAGCAGCATCCACGTGG - Intronic
1167124794 19:47542080-47542102 GTTTTCCAGGCTCATCCGTGGGG - Intronic
1168366375 19:55791727-55791749 ATTATTCAGCATCATTGATGAGG + Intronic
1168396710 19:56054602-56054624 GTTTTCAAGGCTCATCCATGTGG - Intronic
1202669049 1_KI270709v1_random:33012-33034 ATTATTCAGCCTTAAACATGAGG - Intergenic
926572333 2:14543491-14543513 ATTTTTCAGCCTTGTCCAGGAGG - Intergenic
927036830 2:19186580-19186602 ATTTTTCACGCTCATCAATCTGG + Intergenic
927587919 2:24325601-24325623 ATTTTTCTGCCTCTTCGATAAGG - Intronic
927908046 2:26876065-26876087 CTTTTTCAGACTCAACCATCAGG + Intronic
928508978 2:31983924-31983946 ATTTTTCAGCCTTAGCTATTGGG - Intronic
928810668 2:35220664-35220686 ATTTTTCAGCCTTCTGCATTCGG - Intergenic
929302421 2:40321010-40321032 AGTTTACAGCCTCTTCCCTGTGG - Intronic
929442225 2:41973259-41973281 ATTTTTCACCCTCATTCCTAAGG - Intergenic
929480282 2:42300001-42300023 GTTTTTAAGATTCATCCATGTGG + Intronic
931787722 2:65635493-65635515 ATTGTTCAGCAACATCCATTTGG + Intergenic
932180937 2:69644937-69644959 ACTCTTCAGCATCATCCATCAGG - Intronic
932267508 2:70381103-70381125 ATTTATAAGGCCCATCCATGTGG + Intergenic
932658567 2:73631780-73631802 AATCTTCAACCTCATCCATTTGG - Intergenic
933369214 2:81394067-81394089 ACTTTTCCACCTCATCCATGTGG + Intergenic
934302567 2:91788073-91788095 ATATTTCAGCCTCATGAATATGG - Intergenic
934330851 2:92066666-92066688 ATTATTCAGCCTTAAACATGAGG - Intergenic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
938470456 2:131555063-131555085 ATTTTCCAGGTTCATCCATATGG + Intergenic
938472467 2:131577499-131577521 ATTTTTCAGGTTCATCCATATGG + Intergenic
938516708 2:132016202-132016224 ATTATTCAGCCTTAAACATGAGG + Intergenic
939475822 2:142685552-142685574 ATGTTTCAGAATCATCCTTGAGG - Intergenic
939959027 2:148549959-148549981 ATTTTTAAGCCTGTTCCAAGTGG - Intergenic
941428321 2:165379275-165379297 ATTTTTAAGGCTCATCCATGTGG - Intronic
943545117 2:189266463-189266485 GTTTTTAAGGGTCATCCATGTGG - Intergenic
944795515 2:203180549-203180571 ATTTTTGAGGCTCCTCCATTGGG - Intronic
945815275 2:214598304-214598326 GGTTTTGAGCCTTATCCATGTGG - Intergenic
948163880 2:235845987-235846009 AAATTTAAGCCTCATCCAGGAGG - Intronic
1169859035 20:10132522-10132544 ATTTTTCAGCCTCCTCCAGCTGG - Intergenic
1170044867 20:12074210-12074232 GTTTTCCAGGTTCATCCATGTGG + Intergenic
1171003868 20:21443905-21443927 AGTGTTAAGCCTCATCCCTGGGG + Intergenic
1171939480 20:31311859-31311881 GGTTTCCAGCTTCATCCATGAGG + Intergenic
1172122838 20:32608735-32608757 CTTTGTCTGTCTCATCCATGAGG + Exonic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1175436993 20:58959980-58960002 CTTTTTCAGCCTGGGCCATGGGG - Intergenic
1178908318 21:36654177-36654199 CTTTTTCAGCTTCATCCCTCTGG - Intergenic
1179448066 21:41447473-41447495 ATTTTCAAGGTTCATCCATGGGG - Intronic
1180470885 22:15654108-15654130 ATTTTCCAGGTTCATCCATATGG + Intergenic
1180472921 22:15677112-15677134 ATTTTCCAGGTTCATCCATATGG + Intergenic
1183608300 22:38879941-38879963 ATTTTTCTTTCTCATCTATGGGG - Intergenic
1203325588 22_KI270738v1_random:12339-12361 ATTATTCAGCCTTAAACATGAGG + Intergenic
949108014 3:223958-223980 ATTTTTCAGACTCTTGCATTTGG - Intronic
950113716 3:10436956-10436978 TTTCTTGAGCCTCATCCACGTGG + Intronic
950344251 3:12277494-12277516 GTTTTTGAGGCTCATCCATGTGG + Intergenic
950385479 3:12655773-12655795 ATTTTTGAGGTTTATCCATGTGG - Intronic
951426916 3:22557158-22557180 ATTTTTCAGCCTGAGTAATGAGG - Intergenic
952578381 3:34801939-34801961 AATCTCCAGCCTCATCCATCTGG - Intergenic
952994606 3:38867145-38867167 TTCTTTCAGCCTCATCTTTGAGG + Intronic
953354889 3:42247584-42247606 TATTTTCACCCTTATCCATGGGG - Intergenic
955107910 3:55917439-55917461 GTTTTCAAGGCTCATCCATGTGG - Intronic
955257777 3:57351605-57351627 ACTTTTGAGATTCATCCATGTGG - Intronic
956933687 3:74075480-74075502 GTTTTTAAGGTTCATCCATGTGG + Intergenic
957174936 3:76795664-76795686 ACTTCTCAAACTCATCCATGAGG + Intronic
957234552 3:77568948-77568970 GTTTTTGAGGTTCATCCATGTGG + Intronic
957499776 3:81039572-81039594 ATTTTTCAGCCTCTTCTGTGGGG + Intergenic
957648167 3:82962347-82962369 ATTTTTCAGGCACATACCTGAGG + Intergenic
957663506 3:83192757-83192779 ATTTTTCACCCTGAACAATGGGG - Intergenic
960632403 3:119745393-119745415 ATTTTGCAGGCACATACATGAGG + Intronic
964491725 3:157243301-157243323 GTTTTTGAGATTCATCCATGTGG - Intergenic
965492672 3:169358898-169358920 ATTTTTAACCCTTACCCATGTGG + Intronic
967316947 3:188158556-188158578 ATTTTCCAGCCTCAACTCTGTGG - Intronic
967355814 3:188569713-188569735 ATGTTTCAGCCTCGGCCATCTGG + Intronic
969015377 4:4100315-4100337 ATCCTCCAGGCTCATCCATGTGG - Intergenic
969797774 4:9539599-9539621 ATCCTCCAGGCTCATCCATGTGG + Intergenic
971984119 4:33797201-33797223 ATTTTTCAGCTTCAGACATTTGG + Intergenic
972839159 4:42910517-42910539 CTTTTTCTGACTCCTCCATGGGG - Intronic
973026236 4:45275656-45275678 ATTATTCAGCCTACACCATGTGG + Intergenic
974615261 4:64271865-64271887 CTTTTTCAGCCTCTGCCATTCGG - Intergenic
974901980 4:68011520-68011542 ATCTTTCAATCACATCCATGAGG - Intergenic
975501859 4:75095302-75095324 GGTTTACAGCTTCATCCATGTGG + Intergenic
975846703 4:78532773-78532795 GTCTTTCAGGTTCATCCATGTGG + Intronic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
977153377 4:93542628-93542650 CTTTTTCAGCATCTTCCTTGGGG - Intronic
977263793 4:94830743-94830765 ATTTTTCAGCAACATCCTTATGG - Intronic
977342643 4:95778542-95778564 TTCTCTCAACCTCATCCATGGGG + Intergenic
977597550 4:98900229-98900251 ATTGTTCAACCTAATACATGTGG + Intronic
978221255 4:106277536-106277558 ATTTCTGAGGGTCATCCATGTGG - Intronic
982989560 4:162254823-162254845 ATTTTTGAGATTGATCCATGTGG - Intergenic
983657638 4:170099171-170099193 ATTGTGAAGCCTCAGCCATGTGG - Intergenic
983837325 4:172406265-172406287 ATTCTTCTGCCTCAGCCAAGTGG + Intronic
983946735 4:173594397-173594419 TTATTTTAGCCTCCTCCATGTGG - Intergenic
984209652 4:176830272-176830294 GTTTTTAAGGATCATCCATGTGG - Intergenic
984886895 4:184457217-184457239 ATTTTCCTGGATCATCCATGTGG + Intronic
985001085 4:185483725-185483747 ATTTTCAAGGTTCATCCATGTGG + Intergenic
985262281 4:188126219-188126241 ACTTTTCTGACTCTTCCATGAGG + Intergenic
986273080 5:6251004-6251026 ATCTTCCAGCTTCATCTATGTGG + Intergenic
988973284 5:36490747-36490769 ATTCTCCAGCCTCAGCCCTGCGG - Intergenic
989505955 5:42228223-42228245 CTTGTTCTTCCTCATCCATGTGG + Intergenic
990529619 5:56660375-56660397 ATTTTTCTCCCTCATCCAGGAGG - Intergenic
991140524 5:63235608-63235630 ATTTTTGAGGTTCATTCATGTGG + Intergenic
995210037 5:109527280-109527302 ACATTTCAGCATCAACCATGTGG - Intergenic
996330082 5:122318739-122318761 ATTTTCCAGCCTCCTCCTTAAGG - Intronic
996349823 5:122526333-122526355 ATTTCTAAGTCACATCCATGTGG + Intergenic
996615035 5:125431050-125431072 ATTTTTCTTCCTCCTCCTTGAGG + Intergenic
996796879 5:127357212-127357234 ATTTTACTGCCTCATTGATGGGG + Intronic
996979580 5:129474194-129474216 GTTTTTGAGGTTCATCCATGTGG + Intronic
998189575 5:140011660-140011682 GTCTTTCAGACTCATTCATGTGG - Intronic
999054030 5:148554400-148554422 ATTTTTAAGGTTCATCCATGTGG - Intronic
1000263652 5:159614336-159614358 GTTTTTCATCCTCATCCTGGAGG + Intergenic
1000383187 5:160647402-160647424 ACTTTTAGGACTCATCCATGAGG + Intronic
1001073548 5:168607042-168607064 GTTTTTCTGTCTCATCCAGGAGG + Intergenic
1001469768 5:172003446-172003468 AGTTTTCTGCCTCATTCATAAGG + Intronic
1002440964 5:179264266-179264288 CTCTTTCACCGTCATCCATGGGG + Intronic
1007049120 6:38808088-38808110 GTTTTTGAGATTCATCCATGGGG + Intronic
1007054160 6:38865207-38865229 ATTTATCATCTTTATCCATGGGG - Intronic
1007577567 6:42935837-42935859 ATTTTTCAGGCACATGCATGAGG + Intronic
1007664879 6:43508283-43508305 ATTCTTGAGCCTCACCCAGGGGG + Exonic
1008367046 6:50693448-50693470 ATCTTCCAGGTTCATCCATGTGG + Intergenic
1009479279 6:64136316-64136338 ATTCCTCAAACTCATCCATGAGG + Intronic
1009731687 6:67616034-67616056 ATTTCTCAGCCTCTTTGATGTGG - Intergenic
1010864519 6:80958378-80958400 ATTTTTGAGAATCATCCATGTGG - Intergenic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1011579821 6:88848898-88848920 ATTTTTCAGACTCTTCTATATGG + Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015047349 6:128791856-128791878 ATATTTCCTCCTTATCCATGAGG + Intergenic
1015435143 6:133177570-133177592 TTTTTTTAGCCTCATCTATTAGG + Intergenic
1015901339 6:138071013-138071035 ATTTTTGAGTGTCATCCTTGAGG - Intergenic
1016477027 6:144438844-144438866 ATTTTACATCATCATCCAGGGGG - Exonic
1017224929 6:152009934-152009956 ATTTTTAAGACTTAGCCATGTGG - Intronic
1019796492 7:3053565-3053587 ATTTTTAAGCCAGATCCATCTGG + Intergenic
1021482370 7:21131927-21131949 ATTTTTCAGCCTGAAAAATGAGG + Intergenic
1024490223 7:49973992-49974014 ATTTTTAAGGTTCATTCATGTGG - Intronic
1024807117 7:53155631-53155653 ATTATTCAGCCTTAAACATGAGG + Intergenic
1024838958 7:53561144-53561166 ATTTATTATGCTCATCCATGTGG + Intergenic
1025319565 7:58080559-58080581 ATTATTCAGCCTTAAACATGAGG - Intergenic
1025477978 7:60951029-60951051 ATTATTCAGCCTTAAACATGAGG - Intergenic
1025554148 7:62282916-62282938 ATTATTCAGCCTTAATCATGAGG + Intergenic
1025560633 7:62370358-62370380 ATTATTCAGCCTTAATCATGAGG - Intergenic
1026668651 7:72367023-72367045 ATTTGTGAGGTTCATCCATGTGG - Intronic
1028579018 7:92385582-92385604 GGTTTCCAGCTTCATCCATGTGG - Intronic
1029000535 7:97150185-97150207 ACTTTTCAAAGTCATCCATGAGG + Intronic
1029789520 7:102827816-102827838 GGTTTCCAGCTTCATCCATGGGG + Intronic
1029960546 7:104685501-104685523 ATTCTTCACCCTCTTCCACGTGG + Intronic
1030572286 7:111243047-111243069 ATTTTTCACCTTCAGACATGTGG - Intronic
1030939739 7:115631190-115631212 ATTTTCCAGCCTCATCTCTTGGG - Intergenic
1032761069 7:134942329-134942351 ATATTTCAGTCTCATCCAAGAGG + Intronic
1033251659 7:139765814-139765836 ATTTGACAGACCCATCCATGGGG - Intronic
1037126723 8:15360734-15360756 ATCTGTCAGCATCAGCCATGTGG - Intergenic
1037175174 8:15938726-15938748 CTTTTTCTGCCTCATCTCTGTGG + Intergenic
1037608260 8:20455526-20455548 ATTTCTGAGCCTCATTCATGAGG - Intergenic
1038182899 8:25245475-25245497 ATTTTTCTAACTCTTCCATGTGG + Intronic
1040100811 8:43501683-43501705 ATTCTCCAGACTCATCCACGTGG + Intergenic
1041312231 8:56528993-56529015 AATTTCCAGCCACATCAATGAGG + Intergenic
1042588706 8:70372904-70372926 ATTTTTGAGACTCATCCATATGG + Intronic
1043185616 8:77145016-77145038 TCCTTTCATCCTCATCCATGAGG - Intergenic
1043208567 8:77480478-77480500 ATTTTTCTGCCTCCTCTCTGTGG + Intergenic
1043259827 8:78182864-78182886 AGTTTTCAATCTTATCCATGAGG + Intergenic
1043604363 8:81982410-81982432 GTTTTTAAGCCTCCTGCATGTGG + Intergenic
1045939256 8:107718771-107718793 ATTATTCTGCCTCTTCCATTTGG - Intergenic
1047653858 8:126953792-126953814 ATTTTATAGCCTCATCAATTTGG - Intergenic
1048449650 8:134522392-134522414 ATTATTCAGCACCACCCATGGGG + Intronic
1048805195 8:138234572-138234594 GTTTTTCAGGTTCATCCCTGTGG - Intronic
1049354928 8:142182836-142182858 ACTGCTCAGCCTCATCCAAGAGG + Intergenic
1050317273 9:4415261-4415283 AGTTCTCAGCCTCATCCACTTGG + Intergenic
1050441878 9:5672328-5672350 ATTCTTCTGTCTCATCCCTGTGG - Intronic
1050641851 9:7676892-7676914 GTTTTTCAGCTTCCTCCATTGGG + Intergenic
1050866701 9:10509408-10509430 TTGTTTCAGCTTCATCCATTAGG + Intronic
1050970265 9:11862176-11862198 CTTTTAAAGCCTCAACCATGAGG + Intergenic
1051599360 9:18857198-18857220 CTTTTTCTACCTCATCCATTCGG + Intronic
1051790119 9:20792471-20792493 ATTTGTCAAACTCATCAATGGGG - Intronic
1052343135 9:27382497-27382519 TTTTTCCACCCTCAGCCATGGGG - Intronic
1053945463 9:43304735-43304757 ATTATTCAGCCTTAAACATGAGG - Intergenic
1056139948 9:83666419-83666441 ATTATTCAGCATCATCTATGGGG + Exonic
1056480075 9:86994070-86994092 GTCTCTCAGCTTCATCCATGTGG - Intergenic
1056606993 9:88093985-88094007 ACTTTTTAGTCTCATCCCTGAGG + Intergenic
1057118398 9:92547511-92547533 GTTTTTGAGGTTCATCCATGTGG - Intronic
1057609521 9:96528068-96528090 ATCTTTAAGGTTCATCCATGTGG + Intronic
1058130846 9:101251170-101251192 CTTTTACAGCCTCTCCCATGTGG + Intronic
1058197721 9:101999524-101999546 ATTTTACTGCCTCATTCAAGTGG + Intergenic
1059594892 9:115709078-115709100 GGTTTCCAGCTTCATCCATGGGG - Intergenic
1060061302 9:120462602-120462624 GTTTTTGAGATTCATCCATGTGG - Intronic
1060260677 9:122071244-122071266 ATATTTCAGCCTCACCGAGGAGG - Intronic
1061557329 9:131379126-131379148 GCCTTTCAGCTTCATCCATGTGG + Intergenic
1203588598 Un_KI270747v1:33313-33335 ATTATTCAGCCTTAAACATGAGG - Intergenic
1186291354 X:8103300-8103322 ATATTTAAGCCTCAACCATCTGG + Intergenic
1187199703 X:17123172-17123194 TTTCTTCAACCTCATCCCTGGGG + Intronic
1187680704 X:21764834-21764856 ATTTTCAAGGTTCATCCATGTGG + Intergenic
1188222894 X:27561711-27561733 ATTTTTAAGGTTCATACATGTGG + Intergenic
1189669424 X:43392160-43392182 ATATTTAAGCCTCAACCATATGG + Intergenic
1189768157 X:44393244-44393266 ACTTTTGAGCCTCTTCCATGGGG - Intergenic
1192722049 X:73709495-73709517 ACTCTTCATCCTCATTCATGAGG + Intergenic
1194062778 X:89225226-89225248 ACTTCTCAGAATCATCCATGAGG + Intergenic
1194797589 X:98231509-98231531 ATTTTTCACCATCAACCAAGTGG - Intergenic
1195504059 X:105636682-105636704 ATTTCTCTGCCTCATCCACTAGG - Intronic
1198089540 X:133313887-133313909 ATTTTGCAGTCTCATCAATGTGG - Intronic
1198603058 X:138305749-138305771 GTTTTTCAGCAACCTCCATGTGG - Intergenic
1201669753 Y:16505849-16505871 GTTGCTCAGTCTCATCCATGGGG + Intergenic