ID: 1144191821

View in Genome Browser
Species Human (GRCh38)
Location 17:12853400-12853422
Sequence CCTGATCTACAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144191811_1144191821 -7 Left 1144191811 17:12853384-12853406 CCCACGTCCCAGAGCCCCTGATC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 206
1144191810_1144191821 13 Left 1144191810 17:12853364-12853386 CCGAAACGTGTCATGAAATGCCC 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 206
1144191812_1144191821 -8 Left 1144191812 17:12853385-12853407 CCACGTCCCAGAGCCCCTGATCT 0: 1
1: 0
2: 3
3: 21
4: 244
Right 1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG 0: 1
1: 0
2: 2
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144191821 Original CRISPR CCTGATCTACAGAAGGAGGT GGG Intronic
900149108 1:1170566-1170588 CCTGAGCAAAAGAAGGAGGGAGG - Intergenic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
901983136 1:13052471-13052493 CTTGACCCATAGAAGGAGGTAGG + Intronic
901998953 1:13176447-13176469 CTTGACCCATAGAAGGAGGTAGG - Intergenic
902017439 1:13319578-13319600 CTTGACCCATAGAAGGAGGTAGG - Exonic
904729231 1:32576081-32576103 CCTTATTTACAAAAGCAGGTAGG - Intronic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907639421 1:56171120-56171142 CCAGATCTACTGAAGGTGGCTGG + Intergenic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
909473430 1:76055633-76055655 CCTGAACTACAGAAGTGGTTTGG + Intergenic
916016846 1:160757342-160757364 GCTGATCTGGAAAAGGAGGTGGG + Intergenic
916556836 1:165900620-165900642 CCAGATCTACAGAAGGAAGGGGG + Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
920154286 1:203935749-203935771 CCTGTTCTACAGAAAGATGTAGG - Intergenic
921005751 1:211091726-211091748 CTTCATCCACAGAAGGAGGTAGG + Intronic
921731668 1:218586056-218586078 CCCGAGCCACAGCAGGAGGTGGG - Intergenic
922944007 1:229494794-229494816 CCTGAGCAACAGAAAGAGGGTGG + Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923955222 1:239010124-239010146 CCTGATCTATAATAGGAGGAAGG - Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924432614 1:244009674-244009696 TCTGATCATCAGGAGGAGGTAGG + Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1070377897 10:75852020-75852042 TCTGTTCTAGAGAAGGGGGTGGG - Intronic
1071760070 10:88593128-88593150 CCTGATCATCATAAGGAAGTAGG - Intronic
1072664925 10:97385791-97385813 CCTTGTCTACAGAGTGAGGTTGG - Intronic
1072958364 10:99906818-99906840 CCTGACCTACAGAAGCAGCGAGG + Intronic
1073036800 10:100569826-100569848 CCGGATTTACAGCAGGAGATGGG - Intergenic
1075166458 10:120072158-120072180 CCTAAGCTACAGAAAGCGGTAGG - Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083769314 11:64857553-64857575 CCTCATCTACAGGGTGAGGTGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1087121689 11:94581628-94581650 AATGGTTTACAGAAGGAGGTGGG + Intronic
1087657303 11:100939837-100939859 CCTGAACTTCAGATGGAGGCGGG + Intronic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088590668 11:111399966-111399988 CCTGATCTACAGAGAGAAATGGG + Intronic
1088618242 11:111655471-111655493 CCTGACCTATAGAAGCAGTTTGG - Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1091953561 12:4616027-4616049 CCTGTTTAACAGAAGGAGGTTGG + Intronic
1094261772 12:28508564-28508586 CCTGATCAATAAAAGGAGGTAGG - Intronic
1094409195 12:30151056-30151078 CCTGATCAACGAGAGGAGGTAGG + Intergenic
1094795139 12:33963308-33963330 CCTGCTTCACAGAAGGAGCTAGG + Intergenic
1095107770 12:38256404-38256426 CCTGCTTCACAGAAGGAGCTAGG + Intergenic
1098987153 12:77024938-77024960 CTTGAACTACAAATGGAGGTTGG + Intronic
1100188089 12:92159305-92159327 CCTGATGTACTTAAGGAGGCAGG + Intergenic
1101331176 12:103759004-103759026 CCTGATCTCCACATGGAGGCAGG + Intronic
1102799826 12:115722427-115722449 CCTAATCTGTAGAAGAAGGTAGG - Intergenic
1103415101 12:120738171-120738193 CCTGAGCTTCTGAGGGAGGTGGG + Intronic
1104493780 12:129217871-129217893 CCTCTTATACAAAAGGAGGTAGG - Intronic
1104842385 12:131831328-131831350 CTTGATCTTCTGTAGGAGGTGGG + Intronic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1106185873 13:27409135-27409157 CCTGAGCTACAGAAAGAAATAGG + Intergenic
1106476262 13:30100813-30100835 CCTGATAGACAGAAGGTGCTTGG - Intergenic
1107021953 13:35761026-35761048 CCTGATTTACAGCAGGACTTTGG + Intergenic
1108460852 13:50665996-50666018 CCTGATCACCAGTAGGAGGTAGG + Intronic
1109052820 13:57506624-57506646 CCAGATCATCAGCAGGAGGTGGG - Intergenic
1113748847 13:112764881-112764903 CCTGAGCTAAGGAAAGAGGTTGG - Intronic
1114197212 14:20489413-20489435 CTAGTTCTACAGAAGGAGGGTGG + Intergenic
1117473698 14:56072636-56072658 GCAGAACTAAAGAAGGAGGTAGG + Intergenic
1118017620 14:61675920-61675942 CCTGATCGTCAGAAGAATGTAGG - Intergenic
1119160328 14:72447025-72447047 CCTGAGCTAGAGGAAGAGGTGGG + Intronic
1121588628 14:95082087-95082109 ACTGATCTACAGCAGGAAGCAGG + Intergenic
1122304504 14:100753534-100753556 CCTGATCATCAGAAAGAGATAGG - Intergenic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1124397579 15:29317846-29317868 ACTGACCCACAGAAGGAGGCGGG + Intronic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1125614360 15:40996753-40996775 CCTGAACTTCAAAAGGTGGTTGG - Intronic
1126128952 15:45322040-45322062 CCTGAGCTACAGAAAGAAATAGG + Intergenic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127145480 15:56018822-56018844 CCTGAGCTATAGAAGGAAATAGG - Intergenic
1128150076 15:65357338-65357360 CCAGATCAACAGAAGGCTGTTGG + Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129075968 15:72996437-72996459 CCTGAGCTACAGAAGGGAATAGG + Intergenic
1129362350 15:75031829-75031851 CCTGAGCTACAGAAGGAAATAGG + Intronic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1131838457 15:96413027-96413049 ACTCCTCTAAAGAAGGAGGTTGG + Intergenic
1132202597 15:99965111-99965133 CCTGACCTACAGACAGGGGTTGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1136548566 16:30969307-30969329 CCTGAACAAGAGAAGGAGGCTGG + Exonic
1137569791 16:49557876-49557898 CCAGATCTAGAGAAGGAGTCTGG + Intronic
1138724378 16:59119898-59119920 CCTGATCAGCAAGAGGAGGTAGG - Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1140477786 16:75247585-75247607 CCTGACCCAGAGAAGGAGTTTGG - Intronic
1140810922 16:78577047-78577069 CCTGAGCTATAGAATGAGATGGG - Intronic
1141188043 16:81802521-81802543 CCTCATCAAGAGAAGGTGGTAGG - Intronic
1143460645 17:7101386-7101408 AATGAATTACAGAAGGAGGTGGG + Exonic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1146049096 17:29534618-29534640 CTTGCTCTACCTAAGGAGGTTGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1159727120 18:71975233-71975255 CCTGATCCACGAGAGGAGGTGGG + Intergenic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1160127211 18:76186668-76186690 CCTGATCCACAGCAGGCGCTAGG + Intergenic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1163190395 19:15673043-15673065 CCTGATCTAGGGAAGGCCGTAGG - Exonic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1166755711 19:45189794-45189816 CCAAATCTACAGAAGGATATCGG - Intronic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927512446 2:23652841-23652863 CCTGATAAAAAGGAGGAGGTGGG - Intronic
927773973 2:25887798-25887820 CCTGATCATCAGGAGGAAGTAGG + Intergenic
929903329 2:46024651-46024673 CCTGGACTTCAGAAGGAGGGTGG + Intronic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
932639483 2:73429067-73429089 CCTGATCTGCATAAGGAAATAGG + Intronic
935469815 2:103444646-103444668 ACGGATCTACTGATGGAGGTTGG + Intergenic
935921678 2:108022340-108022362 CCTGGTCATCAGAAGGAGGTGGG + Intergenic
938268459 2:129947380-129947402 CCTGACCTACACCAGCAGGTGGG - Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
939209588 2:139156726-139156748 CCTGGGCTACAGAAAGAGCTGGG - Intergenic
939966316 2:148613779-148613801 CCTGAGCTACAGAAAGAGACTGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
941095576 2:161237438-161237460 CCTGCTCTACAGAGGGAGCGCGG + Intergenic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
942161762 2:173196326-173196348 CCTGACCTACACAGGGAGGGAGG - Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943254183 2:185572591-185572613 CCTGATCTACAGTAGTAATTTGG + Intergenic
943483737 2:188454600-188454622 CCTGATCTACTGACAGAGGCAGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1173337092 20:42121238-42121260 CCTGCTCTAGAGTTGGAGGTTGG + Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175743466 20:61436726-61436748 CCTGACCTCCAGATGGGGGTGGG - Intronic
1175874751 20:62224098-62224120 CCTGATCAGCAGGAGAAGGTGGG + Intergenic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1178405138 21:32317374-32317396 CCTGCACTACAGGAGGAGGTTGG + Intronic
1180043018 21:45289894-45289916 CCTGAACTCCAAAGGGAGGTGGG + Intergenic
1180478623 22:15733162-15733184 CCTCAGCTACACAAGGAAGTGGG + Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1183143837 22:35971106-35971128 CCTGATATACTGCAGTAGGTGGG + Intronic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1185221513 22:49631251-49631273 CCAGATCTTCAGGAGAAGGTGGG - Intronic
1185371974 22:50465129-50465151 CCTGGATGACAGAAGGAGGTCGG + Exonic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
953728111 3:45418573-45418595 CTTGATTTACAGAAACAGGTAGG - Intronic
956721915 3:72125453-72125475 CCTGATCTACATAAACAGGTGGG + Intergenic
956950940 3:74281252-74281274 CCTGATCTACAGGAGAGAGTTGG + Intronic
960137185 3:114117789-114117811 CTTGATCTTCAGGAGAAGGTAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
966098187 3:176231506-176231528 CCTGATCTAGAGAAGGTTATTGG - Intergenic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
968242020 3:197098558-197098580 CCTGAGCAACAGAGCGAGGTGGG - Intronic
968684042 4:1944254-1944276 CCTGGTTTCCTGAAGGAGGTGGG + Intronic
969309986 4:6347507-6347529 CCAGATCTAAAGTAGGAGGCCGG + Intronic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974919296 4:68218449-68218471 ATTGATTTACAGAGGGAGGTAGG + Intergenic
976771074 4:88653304-88653326 CCTGCTTTACATAAGGTGGTGGG + Intronic
981295194 4:143123686-143123708 CCTGATCAACAGGGAGAGGTAGG + Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982995634 4:162340714-162340736 CCTGAGCTAAAGAAGCTGGTTGG - Intergenic
984859426 4:184223857-184223879 CCTGAGCTACAGAAAGAAATGGG + Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
986590438 5:9363407-9363429 CCTTACCTACTGCAGGAGGTGGG - Intronic
986972180 5:13349774-13349796 CCTCTTCTACAAGAGGAGGTGGG - Intergenic
987263604 5:16228788-16228810 CCTGATCTATAGAAGCTGTTTGG - Intergenic
988844086 5:35112086-35112108 CCTGATTAACACAGGGAGGTCGG - Intronic
990115830 5:52389243-52389265 CCTGAACTACTGAAGGAGCCAGG + Intergenic
992001122 5:72437526-72437548 CCTGATCATCAGGAGGAAGTAGG + Intergenic
992491235 5:77246745-77246767 CCTGGTCTACTGGAGCAGGTTGG + Intronic
995859817 5:116629421-116629443 CCTGATGATCAGGAGGAGGTGGG + Intergenic
996544119 5:124659635-124659657 ACTGATCTACAAGAGGTGGTGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
999374005 5:151073964-151073986 ACTGCTCTACAGAAGGACCTCGG + Intronic
999387256 5:151163017-151163039 CCTGAGCTACAGCAGCAAGTAGG + Intergenic
1000486163 5:161847503-161847525 TCTAAGCTACAGAAGAAGGTGGG + Intronic
1001653242 5:173329730-173329752 CCTGTTCTCCAGGAGGAGGGTGG - Intergenic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005836642 6:29714438-29714460 CCTAATCTCCAGGAGGAGGTTGG + Intergenic
1006391973 6:33763887-33763909 CCAGCTCTACAGGAGGAGGAAGG - Intergenic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1011635599 6:89369940-89369962 CCTGAACCAGAGAAGGATGTGGG - Intronic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1014796394 6:125729901-125729923 CCTCATTTACAAAAGGAAGTGGG - Intergenic
1016673782 6:146739210-146739232 CCTAATCTATACAAGGATGTTGG - Intronic
1018149114 6:160921928-160921950 CCTGATGTAGAGGAGGGGGTTGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1020580422 7:9992193-9992215 CCAGATTTAGAGAAGGAGGCAGG + Intergenic
1021925740 7:25532025-25532047 CCTGATCTCCAGTTGGTGGTGGG - Intergenic
1021990267 7:26134586-26134608 CCTGTGTTACATAAGGAGGTGGG - Intergenic
1022530086 7:31061542-31061564 CCTGACCCACAGGAGGAGGCTGG + Intronic
1022606492 7:31820526-31820548 CCTGATTTACAAAACTAGGTAGG - Intronic
1024193118 7:47032773-47032795 TCAGTTCTACAGAAAGAGGTTGG + Intergenic
1026946211 7:74317808-74317830 CCTGATCAACACTGGGAGGTTGG + Intronic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1027925842 7:84462651-84462673 CCTGTTCTAAAGAAGAAAGTAGG + Intronic
1028358934 7:89944309-89944331 CTTAGTCTACAGAAAGAGGTAGG - Intergenic
1029306015 7:99620582-99620604 GCTGAACTACAGAAGGACGGGGG - Intronic
1031436041 7:121733105-121733127 CCTGATCAACACAAGGAGGCAGG - Intergenic
1031591745 7:123601345-123601367 TCTGATATACAGACGGAGATAGG - Intronic
1032926818 7:136615596-136615618 CCTGTTCTACAGCTGGAGGCAGG + Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1036921793 8:12863081-12863103 CCTGACCTTCAGAAGTAGATGGG + Intergenic
1038520782 8:28230379-28230401 CCTGGTCATCAGGAGGAGGTAGG + Intergenic
1042383845 8:68150612-68150634 CCTAATCATCAGAAGCAGGTAGG - Intronic
1046163440 8:110397028-110397050 TCTGATCATCAGAAGGAGGCAGG + Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049819213 8:144624443-144624465 ACTGGTCTTCAGAAGGAGATTGG - Intergenic
1050420846 9:5463866-5463888 ACTACTCTACAGAAGTAGGTAGG + Intronic
1051143539 9:14003520-14003542 CCTGATCATCAGGTGGAGGTAGG - Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1055435010 9:76284071-76284093 ACTGGTCTCCAGAAAGAGGTAGG + Intronic
1058669356 9:107347591-107347613 CATCTTCTACAGAAGGAAGTGGG - Intergenic
1058897102 9:109409890-109409912 CCTGAGCTACATAAGGAAGTTGG - Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1189359811 X:40341220-40341242 CATGATCTTCAGGAGGAGGTAGG - Intergenic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1196579798 X:117365380-117365402 AATGATCTACAGCAGGAGGTTGG - Intergenic
1196902690 X:120401437-120401459 CCTGATTATCAGGAGGAGGTAGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199616831 X:149662693-149662715 TCTGATCATCAGGAGGAGGTAGG - Intergenic
1199625810 X:149740555-149740577 TCTGATCATCAGGAGGAGGTAGG + Intergenic
1199927780 X:152486849-152486871 CCAGATCTGCAAAAGGTGGTTGG - Intergenic