ID: 1144192391

View in Genome Browser
Species Human (GRCh38)
Location 17:12858528-12858550
Sequence GCCCCCTTTTGCTACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144192391_1144192395 18 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192395 17:12858569-12858591 GAAAAATAACTCCCAGGGATAGG 0: 1
1: 0
2: 0
3: 20
4: 255
1144192391_1144192394 13 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192394 17:12858564-12858586 CTAAAGAAAAATAACTCCCAGGG 0: 1
1: 0
2: 0
3: 35
4: 349
1144192391_1144192393 12 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192393 17:12858563-12858585 ACTAAAGAAAAATAACTCCCAGG 0: 1
1: 0
2: 1
3: 32
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144192391 Original CRISPR GCCCCCTTTTGCTACTTTCA AGG (reversed) Intronic
906448006 1:45920394-45920416 ACCCCCTTTTGCTGCTTCCTAGG + Intronic
907830377 1:58059198-58059220 ACCCCATTTTGCTGCTTCCAAGG - Intronic
909350015 1:74640919-74640941 GTCCCATTTTGCTACATTGAAGG + Intronic
913546938 1:119878372-119878394 GCCCACTTTGGCTACATTCCAGG + Intergenic
917637824 1:176954271-176954293 GCCTCCTCTTTCTGCTTTCAAGG - Intronic
917941159 1:179923105-179923127 GCCCTCTTTTGCTCATTTCCTGG - Intronic
919545033 1:198905134-198905156 ACCTCAGTTTGCTACTTTCAAGG - Intergenic
920800564 1:209183579-209183601 GCCCCCTCTGGCTGCTTTCATGG - Intergenic
923808781 1:237289109-237289131 GCCGCCCTTTCCTACTTCCATGG + Intronic
1064814535 10:19244014-19244036 GCTTCCTTTGGCTAATTTCAAGG - Intronic
1065563908 10:26990034-26990056 CCCCCATTTTGCTACTCTCTAGG + Intergenic
1066293996 10:34038398-34038420 CCCCAATTTTTCTACTTTCAAGG + Intergenic
1067050442 10:43014294-43014316 AGCCTCTCTTGCTACTTTCAAGG - Intergenic
1068765609 10:60759657-60759679 GACCCCTTCTCCTACTTTTAAGG + Intergenic
1070410108 10:76131641-76131663 GCCACCTTTTGCTATTTTGATGG + Intronic
1070512852 10:77176944-77176966 GCCTCCTTCTTCTACTTTTAAGG - Intronic
1070589037 10:77788592-77788614 GCCCCCTTCTGCTACTTTTCTGG - Intergenic
1071035741 10:81242500-81242522 CCCCACTTTGGCTTCTTTCAAGG - Intergenic
1071494322 10:86157378-86157400 GCCCCCTTTTCCTGCTTGGAGGG - Intronic
1075487798 10:122840158-122840180 GGCCTCTTTTGCTTCTTTGAAGG + Intronic
1076826414 10:132971870-132971892 GCCTCCTCTTGCTCCTTTCGGGG - Intergenic
1080228669 11:29990455-29990477 GGCCCATTTTGCCACTTTGATGG - Intergenic
1081333585 11:41835170-41835192 GCATTCTTTTGCTACTTACATGG + Intergenic
1081825396 11:46046119-46046141 TCCATCTTTTGCTATTTTCAGGG + Intronic
1086903868 11:92397004-92397026 GGCCCTCTTTGTTACTTTCATGG + Intronic
1087022876 11:93620999-93621021 GCCCCATTCTGCACCTTTCACGG + Intergenic
1087081358 11:94173944-94173966 GGCTCCTTTTGGTGCTTTCAGGG + Intronic
1089325965 11:117657203-117657225 GGGCCCTTTTGCAAATTTCAAGG - Intronic
1089624918 11:119745275-119745297 GGCCCCTTTAGCTGCGTTCAGGG + Intergenic
1092960129 12:13588902-13588924 TTCCTCTTTTGCTCCTTTCAAGG - Intronic
1094342417 12:29427742-29427764 GACCCCTGTTGCTACTCTCCTGG - Intronic
1095978746 12:47958064-47958086 AGCCCCTTTGGCTGCTTTCATGG - Intergenic
1098753897 12:74332629-74332651 TTCCCCTATTGCTAATTTCAGGG - Intergenic
1099738338 12:86600029-86600051 CACCCTGTTTGCTACTTTCATGG - Intronic
1100578972 12:95920828-95920850 GCCCTCTTTTGCTTTTTTAATGG - Intronic
1105406087 13:20133778-20133800 GCCCACTTTTCCTAGTTTCTAGG - Intergenic
1106005473 13:25766084-25766106 GCTCTCTTGTGATACTTTCATGG + Intronic
1106358116 13:29004013-29004035 CCCTCATTTTGCTACTTTTATGG + Intronic
1107024092 13:35782037-35782059 GCCTCCTTTTGCCATTTTGATGG - Intronic
1114166414 14:20223207-20223229 CCTTCCTTTTGCTACTCTCAGGG - Intergenic
1117094310 14:52282091-52282113 CCCCCCATTTGCTACTCTCTAGG - Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1120101611 14:80451025-80451047 AGCCCCTTTGGCTGCTTTCATGG - Intergenic
1120419491 14:84265337-84265359 GCCCACTTTTGCCACTTCCCAGG + Intergenic
1120532125 14:85644570-85644592 GCCACCTTTTGCAAATTTCTGGG + Exonic
1121941358 14:98073927-98073949 CCCTCCTTTTGCAAATTTCAAGG - Intergenic
1124076345 15:26448515-26448537 GCCCCATTTTTGTACTTTTAAGG + Intergenic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130518009 15:84640990-84641012 TCCCCCTTTTACTCCTTTGAGGG - Exonic
1131862652 15:96670616-96670638 TCCCCCTTTTTCTGCTTTGAGGG + Intergenic
1137039896 16:35600828-35600850 GCCCACTTCTGCAATTTTCAAGG - Intergenic
1137711389 16:50569283-50569305 GGCCCCTTTTCCTGCTTCCAAGG + Intronic
1141523727 16:84598357-84598379 GCTCCCTTTACCTACCTTCAGGG - Intronic
1141841136 16:86574835-86574857 GCGGCCATTTCCTACTTTCAGGG + Intergenic
1144192391 17:12858528-12858550 GCCCCCTTTTGCTACTTTCAAGG - Intronic
1144299530 17:13910453-13910475 CCCCCTTTTGGCTGCTTTCACGG - Intergenic
1146949700 17:36897359-36897381 GCCCCATTTTTCTAATTACAGGG - Intergenic
1147427048 17:40350912-40350934 GCCACCTTCTGCTCTTTTCATGG + Intronic
1149408286 17:56377463-56377485 GCCCCGTTTTACTGCATTCAGGG - Intronic
1150454383 17:65294996-65295018 GCCTCCTCTTGCTTCTTTAAGGG - Intergenic
1153506401 18:5803764-5803786 AGCCCCCTTGGCTACTTTCATGG - Intergenic
1156013422 18:32521093-32521115 GCCTCGTTTTGCTTTTTTCATGG - Intergenic
1156319143 18:36002016-36002038 TCCCCCTCTGGCTTCTTTCAAGG + Intronic
1157423687 18:47567230-47567252 GCCCTCTATTGCTAGGTTCACGG + Intergenic
1160602581 18:80025196-80025218 CACCCCTTTTGCTACTCTCCAGG - Intronic
1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG + Intronic
1163228101 19:15979215-15979237 GCCCCCATTGCCTACCTTCAGGG - Intergenic
1168000888 19:53445198-53445220 ACCCTCTTTCGCTATTTTCAAGG + Intronic
929549676 2:42881513-42881535 GCCCCCACTTGCTCCTTCCAAGG + Intergenic
930725931 2:54681425-54681447 GCCTCCTTCATCTACTTTCAAGG + Intergenic
933459667 2:82565552-82565574 TCCCCCTTTGGCTTCTTTCAAGG - Intergenic
936506093 2:113108486-113108508 GCCTCCTTTCTCTACTTTTAAGG + Intronic
939628964 2:144512386-144512408 GCCCTCCTTTCCTACCTTCAGGG + Intronic
939976398 2:148721445-148721467 TTCCCCTTTGGCTTCTTTCAAGG + Intronic
941378086 2:164755497-164755519 TTCCCCTTTTACTACTTTTAAGG + Intronic
942319558 2:174724629-174724651 GCCCCTTCTGGCTGCTTTCATGG + Intergenic
943143997 2:184018665-184018687 AGCCCCTTTGGCTGCTTTCACGG - Intergenic
944318918 2:198313046-198313068 GGCCCCTTTTGTTACCTTCGGGG - Intronic
944943031 2:204651523-204651545 AGCCCCTTTTGCTGCTTTCATGG + Intronic
945899107 2:215518100-215518122 GCCATCTTTTGTTACTCTCAGGG - Intergenic
945977982 2:216285431-216285453 GCCCCCATTTGCTCCTCACAGGG + Intronic
947384906 2:229581100-229581122 GCCCCTTTGTGCTGCTTTTAAGG - Intronic
948087367 2:235262813-235262835 GCCCCCTTGGGCTAGTGTCAAGG - Intergenic
1170703347 20:18724064-18724086 GCCCCCTTTTAAGACTTTCCTGG + Intronic
1173351720 20:42251647-42251669 GCTCCCATATGCTGCTTTCATGG - Intronic
1174927378 20:54775223-54775245 GCCTCATTTTGCAAGTTTCATGG - Intergenic
1175055416 20:56193244-56193266 GCCTCCTTTTTCTACTTTTAAGG + Intergenic
1175738215 20:61401852-61401874 GCTCCCTTCTCCTTCTTTCATGG - Intronic
1179348188 21:40581269-40581291 ACCACCTTTTGCTAGTTCCATGG + Intronic
1179964234 21:44791836-44791858 ACCCCCTTCAGCTACTTTCATGG - Intronic
1183494067 22:38132574-38132596 GCCCCCATTTGGCACTTGCATGG - Intronic
1183602803 22:38849932-38849954 GGCTCCTTTTGCTGCTTCCAGGG - Intergenic
950726423 3:14920078-14920100 ATCCCCTTTTCCTTCTTTCAGGG + Intronic
951317616 3:21205593-21205615 GCCCCCCTTGGCTGCTTTCATGG - Intergenic
955625909 3:60919072-60919094 GCCCCCTTTGCTTACTTTAAAGG - Intronic
955706079 3:61729105-61729127 AGCCCCTTTAGCTACTTACAGGG - Intronic
955833191 3:63026384-63026406 ACCCCCTTTGGCTGCTTTCGTGG + Intergenic
957524177 3:81358475-81358497 GGCCCCTGTGGCTGCTTTCATGG - Intergenic
959554743 3:107703923-107703945 GCTTCCTTTTGGTATTTTCATGG + Intronic
960849525 3:122037307-122037329 AGCCCCTTTGGCTGCTTTCATGG - Intergenic
960920466 3:122741846-122741868 GCCCCTTTTTGCCAATTTCATGG - Intronic
964720476 3:159764203-159764225 GCACCCCTTTGCTAATTTGAGGG + Intronic
966163121 3:176988772-176988794 TGCCACTTTTTCTACTTTCAAGG - Intergenic
966600699 3:181772474-181772496 GCCCACTGTGGTTACTTTCAGGG + Intergenic
968191359 3:196670041-196670063 CCCTCCCTTTGCTTCTTTCAAGG + Intronic
968849628 4:3070033-3070055 ACCCCCTCTGGCTGCTTTCAAGG + Intergenic
970218597 4:13784714-13784736 GCCTGCTTTTGGTACTTTTACGG - Intergenic
972730148 4:41786852-41786874 TCACCCTATTTCTACTTTCAAGG - Intergenic
974120555 4:57632821-57632843 GTTCCCTTTTGATACTTTCTAGG + Intergenic
976557915 4:86470111-86470133 ACCCCCTTTTGTGACTTTCATGG - Intronic
981652613 4:147076710-147076732 GCTCCCTATTGCTATTTCCAGGG + Intergenic
982778344 4:159465282-159465304 GCCCCCTCTTGCTGCAGTCAAGG - Intergenic
984599262 4:181707190-181707212 GCGCCCTGTTGCTACTTTCCAGG - Intergenic
985173222 4:187174299-187174321 GCCTCCTTCTTCTACTTACAAGG + Intergenic
987551030 5:19381805-19381827 GGCCCCTTTTTCAAATTTCATGG + Intergenic
989198396 5:38738321-38738343 GCCCTCTCTTGCTGCTTCCATGG + Intergenic
990633323 5:57695145-57695167 CACAGCTTTTGCTACTTTCAGGG + Intergenic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
993038898 5:82789517-82789539 GGCCCCTTTTGCCATCTTCAAGG - Intergenic
994669215 5:102746547-102746569 GCCTTCTTTTTCTACTTTGAAGG + Intergenic
994878850 5:105460691-105460713 AGCCCCTTTGGCTGCTTTCATGG + Intergenic
995559396 5:113364446-113364468 AGCCCCTGTGGCTACTTTCATGG + Intronic
996605190 5:125313305-125313327 AACCCCTTTGGCTGCTTTCAGGG + Intergenic
1000687638 5:164272453-164272475 GTCCCCTTTTGCTCCCTTAATGG - Intergenic
1000715640 5:164640623-164640645 GCCCCCTTTTTCTACTTATTGGG + Intergenic
1001142071 5:169152886-169152908 GCCCCCTTTGGCTGCTTCCTTGG - Intronic
1001169646 5:169407040-169407062 GCCTCCTGATGCTACTTACAGGG - Intergenic
1005324886 6:24690367-24690389 GCCCCCTTTTCCCAGGTTCAAGG + Intronic
1009791152 6:68403390-68403412 AGCCCCTGTGGCTACTTTCATGG + Intergenic
1010360522 6:74987611-74987633 GCCCCCAGTGGCTGCTTTCATGG - Intergenic
1010379759 6:75210633-75210655 TCCACCTTATGCTACTTTGATGG - Intergenic
1012342341 6:98142850-98142872 GGCCCCTTTGACTGCTTTCACGG + Intergenic
1014461113 6:121696976-121696998 GCCTCCTTTTTCTCCTTTTAAGG + Intergenic
1017969985 6:159303935-159303957 GCCCCCTTTTCCTGCTTTGGAGG + Intergenic
1018592608 6:165443450-165443472 GGCCCCTGTGGCTGCTTTCATGG + Intronic
1021960570 7:25868919-25868941 GCTCCCTTTTCCTAGTTTCAGGG + Intergenic
1025088427 7:56042349-56042371 GCTCCCTTCTGCTTCTTTCCTGG - Intronic
1030784712 7:113645434-113645456 CCCCACTCCTGCTACTTTCATGG + Intergenic
1032375393 7:131410946-131410968 ACTCCCTTTTCCTTCTTTCAAGG + Intronic
1035356229 7:158277488-158277510 GCCTCCTCTTGCTGATTTCAGGG - Intronic
1036461490 8:8957239-8957261 GCCCCCTGATTCTACTTGCAAGG - Intergenic
1039289983 8:36084177-36084199 TCCTCTTTTTCCTACTTTCAGGG - Intergenic
1039607548 8:38894739-38894761 TCCCCATTTTCCTACTCTCAAGG + Intergenic
1040627866 8:49172592-49172614 GCTTCCTTTTGCTTCTTTCCAGG + Intergenic
1040655160 8:49499365-49499387 GCCCTTTCTTACTACTTTCAAGG + Intergenic
1042845477 8:73166048-73166070 TAGCCCTTTTGCTACTGTCAGGG + Intergenic
1045289812 8:100823399-100823421 GCCCCCCTTTGCTATACTCAAGG - Intergenic
1046980878 8:120335337-120335359 GGCCCCTCCTGCTGCTTTCAAGG - Intronic
1047986295 8:130237860-130237882 GCCCCTTTCTGCTACTTCAAGGG + Intronic
1048273973 8:133051959-133051981 GCCCATTCTTGCTGCTTTCACGG + Intronic
1048758684 8:137767392-137767414 GCCCCCTTTGGCTGCTTTCATGG - Intergenic
1049216603 8:141411178-141411200 GCCCCCTCTTGATTGTTTCAGGG + Intronic
1056031814 9:82561109-82561131 GCCTCCTTTTGCTTTTTTCATGG - Intergenic
1061858451 9:133455762-133455784 CCTCCCTTTTACTACTATCAAGG + Intronic
1186088832 X:6021950-6021972 TCCACCTTTTGCTACTTCCTGGG + Intronic
1188513001 X:30957178-30957200 GCCCCCTTTTACTAGCTCCAGGG - Intronic
1189750507 X:44216196-44216218 CACCCATTTTGCTATTTTCATGG + Intronic
1192054436 X:67758876-67758898 GCTTCCTTTTGCTACTGTTATGG - Intergenic
1193285907 X:79714334-79714356 GCCACCTCCAGCTACTTTCATGG - Intergenic
1194373952 X:93109904-93109926 AGCCCCTGTTGCTACTCTCATGG + Intergenic
1195742998 X:108085010-108085032 GCCACCTTTGGCCACTTGCAGGG + Exonic
1196555969 X:117084648-117084670 CCCCTCTTTTGATAGTTTCATGG - Intergenic
1198486049 X:137088763-137088785 GGCCCCCTTTCCTTCTTTCATGG + Intergenic
1200019430 X:153189402-153189424 TCCACCTTTTGCTACTCTCTGGG + Intergenic
1200681980 Y:6223975-6223997 AGCCCCTGTTGCTACTCTCATGG + Intergenic
1201927049 Y:19298762-19298784 CACCCCTTTTGCTACTCTCCAGG + Intergenic