ID: 1144192391

View in Genome Browser
Species Human (GRCh38)
Location 17:12858528-12858550
Sequence GCCCCCTTTTGCTACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144192391_1144192395 18 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192395 17:12858569-12858591 GAAAAATAACTCCCAGGGATAGG 0: 1
1: 0
2: 0
3: 20
4: 255
1144192391_1144192393 12 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192393 17:12858563-12858585 ACTAAAGAAAAATAACTCCCAGG 0: 1
1: 0
2: 1
3: 32
4: 459
1144192391_1144192394 13 Left 1144192391 17:12858528-12858550 CCTTGAAAGTAGCAAAAGGGGGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1144192394 17:12858564-12858586 CTAAAGAAAAATAACTCCCAGGG 0: 1
1: 0
2: 0
3: 35
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144192391 Original CRISPR GCCCCCTTTTGCTACTTTCA AGG (reversed) Intronic