ID: 1144194648

View in Genome Browser
Species Human (GRCh38)
Location 17:12878658-12878680
Sequence ATTAGTGAAGGCCTGACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144194648_1144194653 13 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194653 17:12878694-12878716 GCTTCAGGAATAGTGAAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 190
1144194648_1144194654 25 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194654 17:12878706-12878728 GTGAAGGAGGGAAGTCTCAGAGG 0: 1
1: 0
2: 3
3: 41
4: 347
1144194648_1144194650 -2 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194650 17:12878679-12878701 ATGCTCTGCTGAAGTGCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 138
1144194648_1144194655 30 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194655 17:12878711-12878733 GGAGGGAAGTCTCAGAGGAGTGG 0: 1
1: 0
2: 2
3: 58
4: 532
1144194648_1144194652 12 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194652 17:12878693-12878715 TGCTTCAGGAATAGTGAAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 215
1144194648_1144194651 9 Left 1144194648 17:12878658-12878680 CCATAGGTCAGGCCTTCACTAAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1144194651 17:12878690-12878712 AAGTGCTTCAGGAATAGTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144194648 Original CRISPR ATTAGTGAAGGCCTGACCTA TGG (reversed) Intronic
901616830 1:10546961-10546983 ATTCCTGAAGGCCTAACCTTGGG - Intronic
901750861 1:11407422-11407444 ATTCGTGGAGGCCTGGCCTTAGG + Intergenic
903257575 1:22113222-22113244 TTTAGTGCAGGCCTGACCCACGG + Intergenic
904212717 1:28896688-28896710 ATGAGTGAGGACTTGACCTATGG + Intronic
904788380 1:32999219-32999241 ATTGCTGAAGGCCTGACCTTTGG - Intergenic
905797229 1:40822619-40822641 ATTGGTGAAGCCCTGCCCCATGG + Intronic
905980666 1:42223230-42223252 AATAGTAATGGCCTGAGCTAGGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908925022 1:69243748-69243770 TATAGTGAAGCCCTGACCTCTGG + Intergenic
911685318 1:100769195-100769217 AATGGTGAAGGCTTGAACTAAGG + Intergenic
912047696 1:105480751-105480773 ATAAGAGAAGGCCTGACATTTGG - Intergenic
913169514 1:116219680-116219702 ATTAGCAAGTGCCTGACCTATGG + Intergenic
916923414 1:169492762-169492784 AATAATGATGGCCTGAACTAGGG - Intergenic
920856921 1:209670443-209670465 ATTTGCTAAGGCCTGACCTTGGG - Intergenic
922683795 1:227623308-227623330 AATAGTGAATGGCTGAGCTAAGG - Intronic
924705037 1:246493968-246493990 AGTGATGAAGGCCTGAGCTAGGG - Intronic
1065980516 10:30890554-30890576 AGCAGTGAGGACCTGACCTAAGG - Intronic
1066307158 10:34156661-34156683 CTTAGTGAGGGCTTGACTTAGGG - Intronic
1067568093 10:47352372-47352394 CTTGGAGAAGGCCTGAGCTACGG + Intronic
1069492925 10:68876814-68876836 ATAAGAGAAGGCCAGACCTTTGG - Intronic
1070995657 10:80778032-80778054 ATCAGTGTAGGCCTGGCCCAGGG + Intergenic
1073051385 10:100669572-100669594 ATGAGTGAGGCACTGACCTATGG + Intergenic
1080631285 11:34079189-34079211 CCTAGTGAAGGTCTGACCTCAGG - Intronic
1081250002 11:40817802-40817824 AAAAGTGAAGGCTTGACCTAAGG - Intronic
1082671368 11:56040551-56040573 ATCAGTGATGGCCTCTCCTAAGG + Intergenic
1087749388 11:101990262-101990284 AGTAGTGCAGGCCTGACAAAAGG + Intronic
1088404209 11:109454623-109454645 ATTAGAGAAACCCTGAACTATGG - Intergenic
1096813248 12:54184945-54184967 AGTTTTGAACGCCTGACCTAAGG - Intronic
1097124225 12:56760720-56760742 AATACTGATGGCCTGAGCTAAGG + Intronic
1098671358 12:73234848-73234870 CTTAGGGAAGCCCAGACCTAGGG - Intergenic
1099315757 12:81080149-81080171 AACAGTGAGGGCCAGACCTAAGG + Intronic
1100678161 12:96890867-96890889 ATAAGTGATAGCCTGAACTAAGG + Intergenic
1101156581 12:101933338-101933360 AATTTTGAAGGCCTGAACTAAGG - Intronic
1106993240 13:35449344-35449366 AACAGTGATGGCCTGAACTAGGG + Intronic
1110342997 13:74414384-74414406 CTTAGGGAAGCCCAGACCTAGGG + Intergenic
1111128714 13:83946368-83946390 AGTTGTGAAGTCCTGACCTCAGG + Intergenic
1111268907 13:85854277-85854299 CTTAGAGAAGCCCAGACCTAGGG + Intergenic
1114151852 14:20049404-20049426 AATGGTGAAAGCCTGACCTGAGG - Intergenic
1115641428 14:35337867-35337889 AGTAGTCACGGCCTGACCTCAGG - Intergenic
1116190703 14:41661859-41661881 ATGAGAGAAAGCCTGACATAAGG + Intronic
1116364644 14:44044767-44044789 ATTAGAGAAGGCCAGACTGAAGG + Intergenic
1116603461 14:46958557-46958579 ACTGGTGAAAGCCTGAACTAAGG + Intronic
1118147894 14:63159873-63159895 ATTAGTGAAGTCCTAACAAATGG - Intergenic
1121389695 14:93563511-93563533 AATAGTGAGGGCCTGAGTTAAGG + Intronic
1126928254 15:53615948-53615970 ATTACTGAAAGCCTGGCCCAAGG - Exonic
1128080673 15:64855178-64855200 ATGAGCAAAGGTCTGACCTATGG - Intronic
1131432209 15:92395877-92395899 TTCAGTGAATGGCTGACCTAGGG - Intronic
1132827556 16:1912695-1912717 ATTGGTGAAGGGCTGATTTAGGG - Intronic
1140393892 16:74610854-74610876 TTTAGTAAAGGCCTGACCTCAGG - Intergenic
1144194648 17:12878658-12878680 ATTAGTGAAGGCCTGACCTATGG - Intronic
1146583972 17:34066136-34066158 AGTGGGGAAGGCCTGACTTAAGG + Intronic
1147779717 17:42932448-42932470 ATTAGTGAAAGCATGAACTTTGG - Intergenic
1148653890 17:49268979-49269001 ATTAGTGTAGGCCAGCCCGATGG - Intergenic
1148674316 17:49436167-49436189 AACAATGAAGGCCTGAACTAGGG - Intronic
1149457034 17:56796720-56796742 AATGGTGAAGACCTGACCTAGGG - Intronic
1157999606 18:52601434-52601456 ATTATTGACAGCCTGACCAAGGG - Intronic
1158782119 18:60663880-60663902 ATTATTGAGGGCCTGTGCTAAGG - Intergenic
1159690892 18:71486091-71486113 ATTTGTGTAAACCTGACCTAAGG + Intergenic
1165461566 19:35946899-35946921 ATTAGTGAAGCCCTGAGTTCAGG - Intergenic
1167566211 19:50258908-50258930 ATTAGTGACTGCTTCACCTAGGG + Intronic
928569157 2:32585594-32585616 ATTCGTGAACTCCTGACCTCAGG + Intronic
935714153 2:105925145-105925167 ATCAATAAAGGCCTGACCTTGGG - Intergenic
938122232 2:128642060-128642082 CTGAGTGAAGGCCTAGCCTAGGG + Intergenic
939857634 2:147379112-147379134 AATGATGAAGGCCTGAACTAAGG - Intergenic
943412648 2:187562081-187562103 AATAGTGAAGGCTTGAGTTAAGG + Intronic
1169267554 20:4175868-4175890 AGTTGGGAAGCCCTGACCTAGGG - Intronic
1172736994 20:37134264-37134286 TTTAATTAAGTCCTGACCTAGGG + Intronic
1174937762 20:54890453-54890475 AATAATGAAGGCCTGAACTTAGG - Intergenic
1175438517 20:58973104-58973126 ATTGGTCAAGGACTGCCCTACGG - Intergenic
1177404402 21:20646393-20646415 CTTTGTGAAGCCCAGACCTAGGG + Intergenic
1178272915 21:31209852-31209874 ATTAGTGAATGCTTCACCTTTGG - Intronic
1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG + Intergenic
954818478 3:53303588-53303610 GTCAGAGAAGGCCTGACTTATGG + Intronic
966764665 3:183449681-183449703 ATTAGTTAAGGTCTGCCCTCAGG + Intergenic
975201967 4:71601641-71601663 ATTAATGAAGGCTTGTCCCATGG + Intergenic
976590583 4:86845669-86845691 AATTGTGAGGGCCTGACCTGAGG + Intronic
981557977 4:146016041-146016063 ATTGGTTAAGAGCTGACCTAGGG + Intergenic
981698165 4:147579955-147579977 ATTGGTTAAGGCCAGAACTAAGG - Intergenic
983476489 4:168218469-168218491 ATGAGTGAAGGTCTGAATTAAGG - Intronic
992200041 5:74374239-74374261 AACAGTGAAGGCCTGAGCCACGG + Intergenic
993698163 5:91086729-91086751 AGTAATGAAGGCCTGAGGTAGGG - Intronic
994798079 5:104332147-104332169 GTTAGTGAAAGCCTGGCCTGGGG - Intergenic
994883591 5:105529379-105529401 GGTAGTCAAGGCCTTACCTAGGG + Intergenic
997844676 5:137275908-137275930 AATTGTGGAGGCCTGACCCAAGG - Intronic
1001353967 5:171002613-171002635 AAGAGTGAAGGCCTGAGTTAAGG + Intronic
1001735418 5:173994532-173994554 AAGAGTGAAGGCCTGAACTAAGG + Intronic
1005450985 6:25972213-25972235 ATTAGTGAAGGCCAGCCTGATGG - Intronic
1008288135 6:49679608-49679630 ATTTGTGATTGACTGACCTAAGG - Intergenic
1009464659 6:63954368-63954390 AAGAGTGAGGGCCTGAGCTAAGG - Intronic
1013121304 6:107143596-107143618 TTTAGTGAAGCCCACACCTAGGG + Intergenic
1013288452 6:108699792-108699814 ACCAGTGAAGGCCTGACCGGTGG + Intergenic
1015835695 6:137417868-137417890 AATGTTGAAGGCCTGAACTAAGG - Intergenic
1024910258 7:54439464-54439486 ATTAGTGAAAGCCCCACCTCAGG + Intergenic
1029232244 7:99080205-99080227 AGTAGTGAAACCCTGACCAATGG + Intronic
1030516168 7:110541041-110541063 AACAGTGAAGACCTGAACTAAGG - Intergenic
1032536799 7:132671274-132671296 CATAATGAAGGTCTGACCTAGGG + Intronic
1033625838 7:143108772-143108794 AAGAGTGAAGGCCTGAGTTAAGG - Intergenic
1036796882 8:11762673-11762695 ATAAGTGAATGGCTGACATAAGG + Exonic
1037347987 8:17920134-17920156 AGTAATGAAGGCTTGGCCTAAGG - Intergenic
1042856846 8:73276392-73276414 ATTCTTGAACGCCTGACCTCAGG + Intergenic
1044064454 8:87682462-87682484 GTTAGTAAAGTCCTGAACTAAGG + Intergenic
1044895193 8:96884312-96884334 AATAGTGAGGGCCTGAATTAAGG - Intronic
1045550074 8:103163665-103163687 ATTAATGAGGGCCTGAACTAGGG - Intronic
1045955668 8:107902962-107902984 ATTAATGATGGCTTGAACTAAGG - Intronic
1047286593 8:123492524-123492546 ATTATGGAAGGCCTTACCCACGG + Intergenic
1048830827 8:138475648-138475670 ATTAGTGAGGTCCTGAACTAAGG - Intronic
1050521492 9:6505511-6505533 AGTCTTGAATGCCTGACCTAAGG + Intronic
1051449697 9:17181809-17181831 ATTAGTGAAGGCCTAATAAAGGG - Intronic
1056411654 9:86334206-86334228 ATTATTGAAAGCCTGCCCTTCGG - Intronic
1056586796 9:87932478-87932500 CTCAGTGAAGGCCTCACCAATGG - Intergenic
1057125476 9:92612846-92612868 GTGAGTGGAGGCCTCACCTACGG - Intronic
1057162274 9:92896867-92896889 CTCAGTGAAGGCCTCACCAATGG - Intergenic
1059324037 9:113492549-113492571 CTTAGTGAAGGCTTGACAAATGG - Intronic
1061262354 9:129487361-129487383 ATGAGTGATTGCCTGACCTCAGG + Intergenic
1062466969 9:136685826-136685848 ATCTGTGAAGGCCTCACCTGTGG - Intronic
1185745114 X:2566430-2566452 ATTCGTGACCGCCAGACCTACGG - Intergenic
1186505295 X:10086745-10086767 ATTTGTGACTGCCTGACCTAAGG + Intronic
1192474648 X:71429728-71429750 AATACTGACGGCCTGAACTAAGG + Intronic
1195009173 X:100718591-100718613 ATTTGTGAAGGCAGGCCCTAGGG - Intronic
1195479093 X:105322111-105322133 CTTGGTGAAGGTTTGACCTAAGG + Intronic
1196909222 X:120468928-120468950 CCTAGAGAAGGCCTGACCGACGG - Intronic